ID: 931551420

View in Genome Browser
Species Human (GRCh38)
Location 2:63450545-63450567
Sequence GCACTGGTGTTAGCAGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 8, 3: 27, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931551420_931551422 -4 Left 931551420 2:63450545-63450567 CCTGGTACTGCTAACACCAGTGC 0: 1
1: 0
2: 8
3: 27
4: 122
Right 931551422 2:63450564-63450586 GTGCCACTGCACACAGCCCCAGG 0: 1
1: 0
2: 26
3: 332
4: 4746
931551420_931551424 9 Left 931551420 2:63450545-63450567 CCTGGTACTGCTAACACCAGTGC 0: 1
1: 0
2: 8
3: 27
4: 122
Right 931551424 2:63450577-63450599 CAGCCCCAGGACCCAAGATCAGG 0: 1
1: 0
2: 2
3: 11
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931551420 Original CRISPR GCACTGGTGTTAGCAGTACC AGG (reversed) Intronic
902190076 1:14756165-14756187 GCTCTGGTGTCAGAAATACCTGG - Intronic
902629301 1:17695293-17695315 GAGCTGGTGTTGGCAGGACCAGG + Intronic
911039897 1:93583191-93583213 GCCCAGGTGTCAGCAGTCCCCGG - Intronic
912108216 1:106306977-106306999 GCACAGGTGCTGGCAGTAACAGG - Intergenic
913051481 1:115120326-115120348 GCAGTGGTCTGAGCAGTACCTGG + Intergenic
913646589 1:120861366-120861388 GCAGGAGTATTAGCAGTACCAGG + Intergenic
914080059 1:144401506-144401528 GCAGGAGTATTAGCAGTACCAGG - Intergenic
914174965 1:145270041-145270063 GCAGGAGTATTAGCAGTACCAGG - Intergenic
914529690 1:148511520-148511542 GCAGGAGTATTAGCAGTACCAGG - Intergenic
915320155 1:155051935-155051957 GCACTGGTGGCAACAGCACCAGG - Intronic
916293170 1:163188455-163188477 GCCCTGGTTTCAGCAGTTCCTGG - Intronic
917001558 1:170367072-170367094 CCACTGGTATTAGCAGGTCCAGG + Intergenic
917991050 1:180379016-180379038 GCATTGGTATTAGCAGGTCCAGG - Intronic
918104628 1:181405896-181405918 GCTTGGGTGTTAGCAGGACCAGG + Intergenic
918961489 1:191283360-191283382 GCACTGGTGGTGGCAGTGGCAGG - Intergenic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
922767186 1:228162318-228162340 GCTGTGGTGTCAGCAGTGCCAGG - Intergenic
1062853081 10:760152-760174 GCACTGGTGGTAGCAGGTCCTGG - Intergenic
1062996163 10:1869343-1869365 ACACTGGAGAAAGCAGTACCCGG + Intergenic
1065808691 10:29420914-29420936 GCAGTGGTGTTGGCAGCATCAGG - Intergenic
1066179550 10:32946702-32946724 GCACTTGTGTTTTAAGTACCTGG - Intronic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1071585399 10:86815605-86815627 GCACTGGTTTTATCTGTAACTGG + Intronic
1071823180 10:89298224-89298246 GCACTGGTGTTAGTGGGACCAGG - Intronic
1073486366 10:103821454-103821476 CCACTGGTGTTAGAATTCCCAGG - Intronic
1075329078 10:121559618-121559640 GGGCTAGTGTTAGCTGTACCAGG - Intronic
1082070014 11:47931597-47931619 GGACTGGGGTTAGGAGTCCCGGG - Intergenic
1083167471 11:60899690-60899712 GCACAGGTCTGAGCAGTACTGGG + Intronic
1083518382 11:63282813-63282835 GCAGTGGTGTTAGCAGTTATGGG + Intronic
1085542815 11:77288353-77288375 GCACTGGTGTTAGCAGGTCGAGG - Intronic
1088608141 11:111551143-111551165 GGAATGGTTTTAGCAGAACCCGG + Intronic
1091764902 12:3113350-3113372 GCACTTGTGTTCCCAGTGCCTGG - Intronic
1092313422 12:7383332-7383354 ACACTGGTGCTAGCAGTGCTGGG - Intronic
1095565696 12:43621229-43621251 GCTCAGGTGTTAGCAGTAGTAGG + Intergenic
1099112971 12:78586432-78586454 GCACTGGTGGTAGTAGTTCTGGG + Intergenic
1099519376 12:83641942-83641964 GCACTGGTGTTAGTGGGTCCAGG + Intergenic
1100317972 12:93463111-93463133 GCACTGGTAATAGTAGTTCCTGG + Intergenic
1100686902 12:96996312-96996334 GCCCTGGTGGTGGCAGTGCCTGG - Intergenic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1100809517 12:98324828-98324850 ATACTGGTGTTAGCAGGTCCAGG + Intergenic
1102912329 12:116726487-116726509 GAACTGGTACTAGCAGGACCGGG + Intronic
1110602271 13:77388496-77388518 GCAGTGATGTTAGAAGTAACTGG + Intergenic
1110933993 13:81260800-81260822 GCATTAGTATTAGCAGTACCTGG + Intergenic
1113536950 13:111075891-111075913 GCACTATTGTTAGCAGGTCCAGG + Intergenic
1114756799 14:25269146-25269168 GCAGTGGTGGTAGTAGTAGCAGG + Intergenic
1115695760 14:35897479-35897501 GCACTGGTGTTAGTGGGACCAGG + Intronic
1117912902 14:60651485-60651507 GCTCTGGGTTTAGCAGTGCCAGG - Intronic
1121617740 14:95324160-95324182 GCAGTGGAATTAGCAGTACCTGG + Intergenic
1123793921 15:23752947-23752969 GCACTGGTATTAATAGGACCAGG + Intergenic
1124177029 15:27435943-27435965 AGAGTGGTGTTACCAGTACCAGG + Intronic
1126215328 15:46147093-46147115 GCAGTGGAGTGAGCAGTTCCAGG - Intergenic
1126661570 15:51038422-51038444 GCACTGGCGTTAGCAGGTCCAGG + Intergenic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1129704115 15:77784827-77784849 GCGCTGGGGTCTGCAGTACCTGG - Intronic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1132263934 15:100449464-100449486 GCACTAGTGTTAGCAGCTCCAGG - Intronic
1135113325 16:19707493-19707515 GCAGTGGTGTTGGCTGGACCTGG - Intronic
1140630706 16:76848685-76848707 GCACTGGAGGTAGAAGTTCCTGG + Intergenic
1142143960 16:88484976-88484998 GCACAGGTGTCTGCAGCACCTGG - Intronic
1142861564 17:2765282-2765304 GAAGTGGTGTTGGCAGGACCTGG - Intergenic
1148027067 17:44595708-44595730 GCACAGGAGTGAGCAGTACGGGG - Intergenic
1153863060 18:9233855-9233877 GCACTGGTGTCAGCAGGACCAGG + Intronic
1156653290 18:39252549-39252571 GCACTGGTGTTAGCAAGTCCAGG - Intergenic
1157820918 18:50767720-50767742 ACATTGGTGTTAGCAGGTCCAGG - Intergenic
1159111898 18:64069468-64069490 GCAATGGTGGTAGCAGTAGTTGG + Intergenic
1159583462 18:70260999-70261021 TCACTGGTGTGGGAAGTACCTGG - Intergenic
1161346969 19:3773129-3773151 CTACTGCTGTGAGCAGTACCTGG - Intergenic
1164560865 19:29291231-29291253 GCACTGCAGTGAGCAGTGCCAGG - Intergenic
1165847776 19:38829688-38829710 GCACTGGTGGTCCCAGTACTCGG + Intronic
1166568833 19:43780755-43780777 GCACTGGTGCTGGCAGGAACTGG - Exonic
925719254 2:6811914-6811936 GCACTTGTGTTCCCAGTACTTGG - Intergenic
929419805 2:41779074-41779096 GCACTGGTATGAGCATTTCCAGG + Intergenic
931551420 2:63450545-63450567 GCACTGGTGTTAGCAGTACCAGG - Intronic
935333490 2:101994583-101994605 GCACTGGTGTCAGCATCACCTGG - Intronic
936292582 2:111237919-111237941 GCACTGGAGTTAGGTGCACCAGG - Intergenic
936399663 2:112155778-112155800 GCACTGGGGTTAGAAATACTTGG + Intronic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
936818162 2:116485115-116485137 GCACTGGTGTTAGTGGATCCAGG - Intergenic
938450370 2:131413562-131413584 GGACTGGGGTTGGCAGTACCTGG + Intergenic
939808035 2:146798361-146798383 ACACTGGTGTTAGCAGAGTCAGG + Intergenic
940878567 2:158922785-158922807 GCAGTGGTGATAGCAGTAGGAGG - Intergenic
941997326 2:171612635-171612657 GCCCTGGTGTTGGCAGCAACGGG - Intergenic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
948075174 2:235160338-235160360 GCAATGCTGTGAGCAGTCCCAGG + Intergenic
1169412503 20:5383408-5383430 GCACTGGTGTTAGCATGTCCAGG - Intergenic
1169534631 20:6525179-6525201 GCACTGATGTCAGCAGGCCCAGG + Intergenic
1179945525 21:44671400-44671422 GCACTGGTGTTACCATGTCCAGG - Intronic
1181387169 22:22554993-22555015 GCACTGGAGGAAGCAGCACCAGG + Intronic
949389484 3:3543465-3543487 GTACTGGAGCCAGCAGTACCTGG - Intergenic
951185795 3:19711527-19711549 GCACTGGTGTTAGCATCCCTGGG - Intergenic
952982132 3:38745323-38745345 ACACTGGTGTTAACAGGAGCAGG - Intronic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
955475032 3:59327733-59327755 GCAGTGGTTTTATCAGTCCCTGG + Intergenic
958640026 3:96794382-96794404 GCACTAGTGTTAGCAGGTCCAGG + Intergenic
958709527 3:97700459-97700481 GCACTTGTCTTAGGAGTGCCAGG - Intronic
965009612 3:163070444-163070466 TCACTGGTGATAGCAGAAACTGG - Intergenic
965074631 3:163960246-163960268 ACACTGGTGTCAGCAGGTCCAGG - Intergenic
970097425 4:12479603-12479625 GCAGTGGTGTGAGCCGTATCTGG + Intergenic
975324203 4:73041559-73041581 GAACTGGTGCTAGCAGTGGCAGG + Intergenic
978322677 4:107515558-107515580 GCAGTGGTCTGAGCTGTACCTGG - Intergenic
978461504 4:108959082-108959104 GCATTGGAGTTTGCAATACCTGG - Intronic
980863796 4:138530013-138530035 GCATTGGTGGTAGCAGCAGCAGG - Intergenic
982226653 4:153173205-153173227 GCACTGGTGTCTGCACTATCAGG + Intronic
983949826 4:173627165-173627187 GCACTGATGTTAGCAGGTCCAGG + Intergenic
985514624 5:335133-335155 GCACCTGTGTTGGCAGTACCAGG + Intronic
988928096 5:36009336-36009358 GCAGTGGTTTGAGCTGTACCTGG + Intergenic
988928831 5:36015707-36015729 GCAGTGGTCTGAGCTGTACCTGG - Intergenic
989133874 5:38134157-38134179 GCTCTGGTGTTGGCAGTCCCTGG + Intergenic
989977459 5:50603055-50603077 ACAGGGGTATTAGCAGTACCAGG + Intergenic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
995304778 5:110631947-110631969 GCTCTGGTATTAGCAGGACCAGG - Intronic
995991688 5:118247478-118247500 GCAGTGGTGTTGTCAGTCCCAGG - Intergenic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
1000028664 5:157382490-157382512 GCACTGGAGTTAGCTAGACCTGG - Intronic
1001029109 5:168248671-168248693 GCTCTGGTGTCAGAAATACCTGG + Intronic
1004705610 6:18121728-18121750 GGACTGGGGTTTGCAGCACCAGG - Exonic
1007815469 6:44522186-44522208 GCACTGATGTTAGAAGAACCAGG + Intergenic
1011160113 6:84380707-84380729 GTACTGGTATTAGCAGGTCCAGG + Intergenic
1011160301 6:84381992-84382014 GTACTGGTATTAGCAGGTCCAGG - Intergenic
1011856739 6:91702309-91702331 GCACTGGTGCTAGCAATGGCTGG + Intergenic
1012039389 6:94185157-94185179 GCAGTGATGTGAGCTGTACCTGG + Intergenic
1012594418 6:101023456-101023478 GCACTGGTAGGAGCAGTACCAGG - Intergenic
1016103271 6:140129114-140129136 ACACTGGTGATAGCACAACCAGG - Intergenic
1016116477 6:140291304-140291326 GCAGTGGTGTTAGCAGGTACAGG - Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1016749743 6:147619684-147619706 GGAAAGGTGTTAGCAGTATCAGG + Intronic
1017182199 6:151564445-151564467 GCACTGGTCTTAGCAGGTCTAGG + Intronic
1018238951 6:161753741-161753763 GCACTTGTGTTCCCATTACCAGG - Intronic
1018622856 6:165748522-165748544 ACAGTAGTGTTAGCAGAACCAGG - Intronic
1022950624 7:35334589-35334611 GCACTGGTTTTAGTATTCCCAGG + Intergenic
1023219227 7:37901658-37901680 GGACTGGGGTTAGCAGTACTTGG + Intronic
1024154074 7:46602559-46602581 GTACTGGTGGTAGCAGGAGCAGG + Intergenic
1025002728 7:55331006-55331028 GCAATGGTGTTACCAGAGCCTGG + Intergenic
1030345848 7:108432084-108432106 CCACTTGTGTTAGCAGTTGCTGG + Intronic
1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG + Intergenic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1040024055 8:42765322-42765344 GCACAGGTGGTAACAATACCAGG - Intronic
1040547130 8:48407379-48407401 GCACTGGGGGCAGCTGTACCCGG - Intergenic
1042649402 8:71023547-71023569 GCACTGGTGTTAGTGGGCCCAGG + Intergenic
1047170124 8:122484632-122484654 GCGCTGGTTTTGGCAGTAACAGG - Intergenic
1049212016 8:141391334-141391356 GCACTGGTTTTTCCAGTAACTGG + Intergenic
1049515919 8:143055614-143055636 GCACTGGTATTTTAAGTACCTGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1053007777 9:34615349-34615371 GCACTGCTGAGAGCAGTCCCTGG - Intronic
1055300649 9:74878326-74878348 ACACTGGTGTTAGTAGGGCCAGG - Intronic
1187180541 X:16939531-16939553 GCAGTGGTCTGAGCTGTACCTGG + Intergenic
1187628260 X:21141354-21141376 GCACTGATGGTAGCAGGTCCAGG + Intergenic
1190925027 X:54895040-54895062 GCCCTGGTGTTAGCAGGTCCAGG - Intergenic
1194192771 X:90857795-90857817 GCAGTGGTCTGAGCTGTACCTGG - Intergenic
1194434043 X:93848620-93848642 GCATTGTTGTTAGCAGGTCCAGG + Intergenic
1196781729 X:119389690-119389712 GCATTGGTGTTATCAGTAGAAGG - Intergenic
1197521026 X:127495905-127495927 GCACTGGTGTCAGCAGGTCCTGG - Intergenic
1199242941 X:145569217-145569239 GCCTTGGTGTTAGCAGGACCTGG - Intergenic
1200063744 X:153495188-153495210 GCACTGGGGACAGCAGGACCAGG - Intronic
1200539399 Y:4440244-4440266 GCAGTGGTCTGAGCTGTACCTGG - Intergenic