ID: 931554266

View in Genome Browser
Species Human (GRCh38)
Location 2:63482702-63482724
Sequence GAAGACTAACCTAGACCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931554266 Original CRISPR GAAGACTAACCTAGACCTGT GGG Intronic