ID: 931557294

View in Genome Browser
Species Human (GRCh38)
Location 2:63519219-63519241
Sequence GGCTACTGGTCTCTGTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931557294_931557304 22 Left 931557294 2:63519219-63519241 CCTGCGCACAGAGACCAGTAGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 931557304 2:63519264-63519286 ACTGCCACCCGCAGGAACATTGG 0: 1
1: 0
2: 0
3: 7
4: 118
931557294_931557302 14 Left 931557294 2:63519219-63519241 CCTGCGCACAGAGACCAGTAGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 931557302 2:63519256-63519278 GCAGAGCCACTGCCACCCGCAGG 0: 1
1: 1
2: 1
3: 16
4: 236
931557294_931557306 27 Left 931557294 2:63519219-63519241 CCTGCGCACAGAGACCAGTAGCC 0: 1
1: 0
2: 0
3: 2
4: 98
Right 931557306 2:63519269-63519291 CACCCGCAGGAACATTGGCATGG 0: 1
1: 0
2: 0
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931557294 Original CRISPR GGCTACTGGTCTCTGTGCGC AGG (reversed) Intronic
901186879 1:7379550-7379572 GGCTGCTGGTGTCAGTGCCCAGG + Intronic
902902991 1:19533173-19533195 GGCTACTCATCTTTGTGTGCTGG - Intergenic
903005030 1:20292832-20292854 GGCTGGTGGTCACTGTGCCCGGG + Intronic
904295865 1:29519409-29519431 GTCTACTGGGCTCTGGGCTCTGG + Intergenic
904874357 1:33642896-33642918 GGCTCCTGGTCTCTCTGCCTTGG + Intronic
905867816 1:41385752-41385774 GGCCGCTGGTGTGTGTGCGCAGG + Intergenic
913291380 1:117275596-117275618 GGCTACTGATGTCTGAGGGCGGG + Intergenic
916318145 1:163473207-163473229 GGAAAATGGTCTCTGTGTGCTGG - Intergenic
1065325098 10:24543845-24543867 GGTTTCTGGTCTCTGTGGCCAGG - Exonic
1066988068 10:42485848-42485870 GGCTACTGCCCTCAGTGTGCTGG + Intergenic
1067467275 10:46510557-46510579 GGCCACTGGTTTCTGTGAGGTGG + Intergenic
1067619911 10:47874048-47874070 GGCCACTGGTTTCTGTGAGGTGG - Intergenic
1068192272 10:53667410-53667432 GGCTACTGGTCCCGGTGAGTGGG - Intergenic
1069490830 10:68859016-68859038 GGCCCCAGGTCTCTGTGGGCAGG - Intronic
1074162072 10:110843690-110843712 GGCTTCTGGTCTGTGTGAACTGG + Intergenic
1077021124 11:417572-417594 GGCTCCGGGGCTCTGCGCGCTGG - Intergenic
1084437929 11:69155022-69155044 GCCTTCGGGTCTCTGTGCACTGG + Intergenic
1093155255 12:15676342-15676364 GGCTTCTGGTATCTGTAGGCTGG - Intronic
1095725468 12:45446933-45446955 GGCTACTGGGCTCTGGGCTGGGG - Intergenic
1095853077 12:46831573-46831595 GGCCCCTGGTCTCTGGGCGGTGG - Intronic
1096042355 12:48528647-48528669 GGGTACTGGTCTTTGGGCTCTGG - Intronic
1107787462 13:43970320-43970342 GGCTGCTGGTCGCTGTGCAGGGG - Intergenic
1121423467 14:93832061-93832083 GGCAGCTGGTGTCTGTGCGAGGG - Intergenic
1122810537 14:104285528-104285550 GGCTCCTGGGCTCTGTGTGTGGG - Intergenic
1122985380 14:105209372-105209394 GGCTACTGAGCTCTGGGCGGGGG + Exonic
1123053516 14:105559084-105559106 GGCTGCTGTCCTCTGTGCTCAGG + Intergenic
1123078093 14:105679498-105679520 GGCTGCTGTCCTCTGTGCTCAGG + Intergenic
1123907091 15:24932035-24932057 GTCTCCTGGCCTCTGTGCGAGGG - Intronic
1123994142 15:25706570-25706592 GGCTCCTGGGCTCTGAGAGCAGG + Intronic
1125827477 15:42688724-42688746 GGCTTCTGGTCTCCGTACTCTGG - Exonic
1132596206 16:751498-751520 GGCTACTGCTCTCTGCGAGTGGG + Intronic
1132603267 16:783253-783275 GCCTCCTGGTCTGTGTGCCCGGG + Intronic
1132631985 16:922344-922366 GGCTACCAGTCGCTGTGGGCTGG - Intronic
1139965672 16:70744115-70744137 GGCTGCTGGTCTCTCTGCCTAGG - Intronic
1144341010 17:14310303-14310325 GGCTACAGGGCTCTGTGCACAGG - Intronic
1144724825 17:17496539-17496561 GGCTCCTGCTCTCTGGGCGCGGG + Intergenic
1152929115 17:83100964-83100986 GCCTACGGGTCTCTGTCCACCGG + Intergenic
1153492937 18:5668446-5668468 GGGTACAGGTGTCTGTGTGCAGG + Intergenic
1154355870 18:13622893-13622915 CGCTTGGGGTCTCTGTGCGCAGG + Intronic
1159585203 18:70277412-70277434 GGCTTCTGGTCTCTGAATGCAGG + Intergenic
1159808751 18:72990343-72990365 GGCTACTGCCCTCTGTGGGGAGG + Intergenic
1160136141 18:76273318-76273340 GGCTCCTGATCTCTGAGCCCTGG - Intergenic
1160939798 19:1614914-1614936 GGACACTGGCCTCTGTGAGCTGG + Intronic
1162786019 19:13035390-13035412 GCATAGTGGTCTCTGTGTGCTGG + Intronic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163761494 19:19139272-19139294 GGCTTCTGGTGTTTGTGCCCCGG + Intergenic
1164217550 19:23163038-23163060 GGCAACTGGTCTGGGTGCCCTGG + Intergenic
926199656 2:10785418-10785440 GGCGACTGGTTCCAGTGCGCTGG + Intronic
928162512 2:28940993-28941015 TTCTACTGGTCTCTGGGAGCTGG + Intronic
931557294 2:63519219-63519241 GGCTACTGGTCTCTGTGCGCAGG - Intronic
932068336 2:68590311-68590333 GGCTAGTGTTCTCTATACGCAGG + Intronic
936261270 2:110961385-110961407 GACTACTGGTGTCTGTTTGCTGG + Intronic
937011835 2:118569841-118569863 GACTACTGGTCTCTCAGTGCTGG - Intergenic
942889689 2:180973922-180973944 GGAGACTGGACTCTGTGCCCTGG + Intronic
1171306502 20:24111920-24111942 GGCAGCTGGTATCTGTTCGCAGG + Intergenic
1171902164 20:30868194-30868216 GACTACAGGTCACTGTGTGCAGG - Intergenic
1172097377 20:32467033-32467055 GGGTAATGGTCTCTGAGCCCGGG + Intronic
1172768393 20:37363171-37363193 GGCCACTGTTCTCTGACCGCCGG + Intronic
1178951617 21:36990251-36990273 TGCAACTGGGCTCTCTGCGCAGG + Intergenic
1179916100 21:44479222-44479244 CACTACTGGTCTCTGTGCATTGG - Intergenic
1180335538 22:11574129-11574151 GACTACGGGTCACTGTGTGCAGG - Intergenic
1181028948 22:20140843-20140865 GGCTACTGACCCCTGTGCCCTGG + Intronic
1182871855 22:33654558-33654580 GGCTCCTGATCTCTTTGCTCAGG + Intronic
1183521650 22:38299155-38299177 GGCTCCTGGCCACTGTTCGCAGG - Intronic
949546974 3:5080839-5080861 GGTTAATGGTCTCTGTCCCCAGG - Intergenic
956317462 3:67954240-67954262 GGCAATTGGTCACTGTGCACCGG + Intergenic
960706502 3:120487284-120487306 GGCAACAGGTCTCTGTGCTGTGG - Intergenic
961752149 3:129103043-129103065 GGCTCCTGGTCTCTGCCTGCAGG - Intronic
969444619 4:7237337-7237359 GCCTTCTGGTCTGTGTCCGCTGG + Intronic
970067504 4:12115917-12115939 GGCTGCTAGTCTATGTGAGCAGG + Intergenic
971066154 4:23035560-23035582 GGCTGCTGTTCTATGTGAGCAGG + Intergenic
975673084 4:76801617-76801639 AGCCGCTGGTCTCTGTGCCCAGG - Intergenic
975897103 4:79106399-79106421 GGCTGTTGGTCTCTGTGCATAGG + Intergenic
979551595 4:121997499-121997521 AGATAGTGGTCTCTGGGCGCTGG - Intergenic
984966713 4:185145737-185145759 GGCTTCTGGGCTCTGTCCACAGG + Exonic
987813083 5:22864627-22864649 GGCTATTGGTTTCTCTGCTCTGG - Intergenic
988919540 5:35927601-35927623 GGGGACTGGTCTCAGTGCTCAGG - Intronic
992549756 5:77849492-77849514 GGCTAATGGTCTCTAAGCGTAGG + Intronic
1001494096 5:172175674-172175696 GCCTTGTGGTCTCTGTGCCCAGG - Intronic
1004307286 6:14512496-14512518 GGCTACTGGTCACTTTGCCAAGG - Intergenic
1015940848 6:138450433-138450455 GGCTACAGCTCTCTATGCCCTGG + Intronic
1018909140 6:168091927-168091949 GGCTACTGGTCACTGGCCACTGG - Intergenic
1019281885 7:204756-204778 TGCCACTGTTCTCTGTGCTCAGG + Intronic
1019983898 7:4641626-4641648 GGCCACTGGCCTCTGAGCCCGGG - Intergenic
1023876334 7:44288228-44288250 GGCTTCGAGCCTCTGTGCGCTGG - Intronic
1024090520 7:45936083-45936105 GGCAACTGGTCTCAGAGCTCTGG - Intergenic
1024200611 7:47102630-47102652 TGCTCATGGTCTCTGTGCCCAGG + Intergenic
1032196764 7:129793938-129793960 GGGTGCTGGTCTCTGTGGGAAGG - Intergenic
1037025236 8:14027750-14027772 GGCTACAGGTCTCTGTGTCTTGG - Intergenic
1041428542 8:57751172-57751194 GAACACTGGTCTCTGTGCTCTGG + Intergenic
1043925346 8:86030534-86030556 GGCTAGTGGCCCCTGTGCCCTGG + Intronic
1048502893 8:134994720-134994742 GGATACTAATCTCTGTGTGCTGG - Intergenic
1054907071 9:70420872-70420894 GGCTAGTGTTCTCTGAACGCCGG + Intergenic
1056279086 9:85022244-85022266 GACTACTGGCCTCTGTGCCATGG + Exonic
1056530007 9:87478754-87478776 GGCTCCTGCTCTGTGTGGGCTGG - Intergenic
1056938485 9:90936172-90936194 GGCAACTGGGCTCAGTGCCCGGG + Intergenic
1057171461 9:92965619-92965641 GGCTGCAGGCCTCTGTGTGCAGG - Intronic
1060550274 9:124481694-124481716 GGCTTCAGGTCTCTGTGGGTGGG - Exonic
1188040952 X:25369464-25369486 GGCTTCTGGGCTATGTGCTCAGG + Intergenic
1189256703 X:39645416-39645438 GGCTACGGGGCCCTGTGTGCAGG + Intergenic
1195288024 X:103404504-103404526 AGCTCCAGGTCTCTGTGCACTGG + Intergenic