ID: 931559291

View in Genome Browser
Species Human (GRCh38)
Location 2:63540857-63540879
Sequence GATCCTCCCTCCAAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 1, 1: 2, 2: 9, 3: 97, 4: 867}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931559289_931559291 -1 Left 931559289 2:63540835-63540857 CCACAACTTCTCAGGCTCAAGTG 0: 18
1: 268
2: 1779
3: 6890
4: 26553
Right 931559291 2:63540857-63540879 GATCCTCCCTCCAAGTAGCTGGG 0: 1
1: 2
2: 9
3: 97
4: 867

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931559291 Original CRISPR GATCCTCCCTCCAAGTAGCT GGG Intronic
900644180 1:3701618-3701640 GCTCATCCTCCCAAGTAGCTGGG + Intronic
901009752 1:6193437-6193459 GCTCCGCCTCCCAAGTAGCTGGG + Intronic
901471908 1:9462961-9462983 AATCATCCTCCCAAGTAGCTGGG + Intergenic
901503529 1:9669272-9669294 GATCCGCCCACCTAGTAGTTGGG + Intronic
901920118 1:12530046-12530068 GCTCAGCCCCCCAAGTAGCTGGG + Intergenic
902527095 1:17066273-17066295 CAGCCTCCCCCCAAGTAGCTGGG + Intergenic
902888420 1:19423801-19423823 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
903043280 1:20548166-20548188 AATTCTCCTGCCAAGTAGCTGGG - Intergenic
903175976 1:21580929-21580951 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
903397124 1:23010368-23010390 TCTCATCCTTCCAAGTAGCTGGG - Intergenic
903418559 1:23201665-23201687 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
903498692 1:23790019-23790041 CAGCCTCCCCCCGAGTAGCTAGG + Intergenic
903698295 1:25226040-25226062 GATTCTTCTGCCAAGTAGCTGGG - Intronic
903746028 1:25587265-25587287 CCTCATCCTTCCAAGTAGCTGGG + Intergenic
903834762 1:26196521-26196543 TCTCAGCCCTCCAAGTAGCTGGG + Intronic
904204459 1:28844404-28844426 CCTCGGCCCTCCAAGTAGCTGGG + Intronic
904487378 1:30835871-30835893 TGTCCTGCCTCCAAGTAGCTGGG + Intergenic
904515755 1:31053586-31053608 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
904663632 1:32103401-32103423 GCTCAGCCTTCCAAGTAGCTGGG - Intergenic
904739574 1:32662866-32662888 CATCAGCCTTCCAAGTAGCTGGG - Intronic
904829582 1:33298232-33298254 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
905088097 1:35402499-35402521 GCTCAGCCCTCCAAGTAGCTGGG - Intronic
905679178 1:39854961-39854983 GCTCCCGCCACCAAGTAGCTGGG + Intronic
905991759 1:42343407-42343429 GATCCTCCCACCTTGTAGCTGGG - Intergenic
906047538 1:42843427-42843449 AATCCTCCCTCCAGGTCACTGGG - Exonic
906054493 1:42904589-42904611 GCTCCTCCCTCCAGGGAGGTAGG - Intergenic
906113112 1:43337796-43337818 CATCCTCCCTTCAGGAAGCTGGG - Exonic
906363693 1:45186703-45186725 GCTTCTGCCACCAAGTAGCTGGG + Intronic
906428446 1:45734554-45734576 CGGCCTCCCACCAAGTAGCTGGG + Intronic
906830949 1:49031201-49031223 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
906863064 1:49382887-49382909 CATCAGCCTTCCAAGTAGCTGGG - Intronic
906884492 1:49629791-49629813 GGTCCTCCCTCCAAGAAACATGG + Intronic
907194096 1:52672536-52672558 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
907376807 1:54050962-54050984 AAGCCTCCCACCGAGTAGCTGGG + Intronic
907785376 1:57606898-57606920 GACTCAGCCTCCAAGTAGCTGGG + Intronic
909010425 1:70328545-70328567 GACTCAGCCTCCAAGTAGCTGGG - Intronic
909036907 1:70603766-70603788 GCTCAGCCCCCCAAGTAGCTGGG - Intergenic
909428886 1:75562580-75562602 AATCCTCCCCCCGAGTAGCTAGG - Intronic
909481910 1:76135024-76135046 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
909663179 1:78106442-78106464 CCTCATCCTTCCAAGTAGCTGGG - Intronic
909681856 1:78300486-78300508 CAGCCTCCCCCCGAGTAGCTGGG - Intergenic
909911282 1:81260838-81260860 CAGCCTCCTCCCAAGTAGCTGGG + Intergenic
909973319 1:82017026-82017048 GCTCCTCCCACCACGGAGCTGGG - Intergenic
910018623 1:82557407-82557429 GCTTCAGCCTCCAAGTAGCTAGG + Intergenic
910160259 1:84264841-84264863 GATTCTCCTCCCGAGTAGCTGGG - Intergenic
910724805 1:90327494-90327516 CATCAGCCCCCCAAGTAGCTGGG - Intergenic
910968858 1:92833990-92834012 AATCCTCCCACTGAGTAGCTGGG - Intronic
911150795 1:94595476-94595498 TCTCCTGCCTCCAAGTAGCTGGG + Intergenic
912332408 1:108831740-108831762 GCTCAGCCCCCCAAGTAGCTGGG + Intronic
912342692 1:108932994-108933016 CCTCAGCCCTCCAAGTAGCTGGG + Exonic
912465688 1:109871981-109872003 CAGCCTCCTCCCAAGTAGCTGGG + Intergenic
912566662 1:110592455-110592477 ATTCCTGCCTCCAAGAAGCTGGG - Intergenic
912820734 1:112865720-112865742 TATCTGCCCCCCAAGTAGCTGGG + Intergenic
912995890 1:114532134-114532156 GTTCAGCCTTCCAAGTAGCTGGG + Intergenic
913031637 1:114910876-114910898 GCTCATCCCCTCAAGTAGCTAGG + Intronic
913046423 1:115077033-115077055 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
913203163 1:116512660-116512682 GTTCAGCCTTCCAAGTAGCTGGG - Intergenic
914739802 1:150454730-150454752 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
914796551 1:150924892-150924914 GCTCGTCCTTCCGAGTAGCTGGG - Intergenic
914864643 1:151416384-151416406 CCTCATCCTTCCAAGTAGCTGGG - Intronic
915132307 1:153704116-153704138 CCTCCTCTCCCCAAGTAGCTGGG - Intergenic
915371746 1:155356978-155357000 CATCATCCTCCCAAGTAGCTGGG - Intronic
915386760 1:155501484-155501506 CTCCATCCCTCCAAGTAGCTGGG + Intronic
915390936 1:155543393-155543415 GCTGCACCCTCTAAGTAGCTGGG - Intronic
915408416 1:155680680-155680702 CTTCAGCCCTCCAAGTAGCTGGG + Intronic
915720885 1:157984796-157984818 AATCATCCTTCCAAGGAGCTGGG - Intergenic
916091753 1:161312902-161312924 CAGCCTCCCCCCAAGTAGCTGGG - Intergenic
916664664 1:166955492-166955514 TCTCGTGCCTCCAAGTAGCTGGG - Intronic
916974796 1:170064467-170064489 CCTCCACCTTCCAAGTAGCTGGG + Intronic
916986471 1:170197486-170197508 GATTCTCCTCCCAAGTAGCTGGG + Intergenic
917350670 1:174074064-174074086 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
917446773 1:175112731-175112753 CCTCAACCCTCCAAGTAGCTGGG + Intronic
917760158 1:178147953-178147975 CCTCCGCCTTCCAAGTAGCTGGG - Intronic
917801702 1:178577247-178577269 CCTCCACCTTCCAAGTAGCTGGG + Intergenic
917819116 1:178743104-178743126 GATTCTCCTTTCCAGTAGCTAGG - Intronic
917819713 1:178749993-178750015 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
917999420 1:180477889-180477911 CCTCATCCTTCCAAGTAGCTGGG - Intronic
918464405 1:184806881-184806903 GCTTCAGCCTCCAAGTAGCTGGG + Intronic
919393862 1:197021201-197021223 CCTCCTCCTCCCAAGTAGCTAGG + Intergenic
919617595 1:199826829-199826851 TCTCATCCCCCCAAGTAGCTGGG - Intergenic
919750515 1:201034812-201034834 GATCCCCCCACCCAGCAGCTGGG + Intergenic
920104527 1:203542294-203542316 CCTCCACCTTCCAAGTAGCTGGG - Intergenic
920136422 1:203772789-203772811 CCTCATCCCCCCAAGTAGCTGGG + Intronic
920196318 1:204229527-204229549 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
920196610 1:204231681-204231703 CATCAGCCTTCCAAGTAGCTGGG + Intronic
920322591 1:205135996-205136018 CAGCCTCCCTCCCTGTAGCTGGG + Intergenic
920507918 1:206529807-206529829 AATCCTCCCACTGAGTAGCTGGG - Intronic
921144832 1:212344085-212344107 GATCAGCCTCCCAAGTAGCTGGG + Intronic
921204876 1:212840292-212840314 AATCAGCCTTCCAAGTAGCTGGG - Intronic
922230146 1:223678546-223678568 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
922528552 1:226325373-226325395 GATCTTCCCTCAATGTGGCTGGG - Intergenic
922929282 1:229376278-229376300 GATTCTCCTCCCAAGTAGCTGGG - Intergenic
923406614 1:233667156-233667178 CATCAGCCTTCCAAGTAGCTGGG + Intronic
924078466 1:240366665-240366687 GTTCAGCCTTCCAAGTAGCTGGG + Intronic
924150159 1:241121821-241121843 GATTCTCCTCCCTAGTAGCTGGG + Intronic
924164110 1:241264380-241264402 GTTTCAGCCTCCAAGTAGCTGGG - Intronic
924182229 1:241450427-241450449 GCTCATCCTCCCAAGTAGCTGGG - Intergenic
924201015 1:241658521-241658543 GCTCAACCCCCCAAGTAGCTGGG - Intronic
924226943 1:241929662-241929684 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
924231110 1:241962411-241962433 GATCTGCCTCCCAAGTAGCTGGG - Intergenic
924529606 1:244882166-244882188 CATCAGCCTTCCAAGTAGCTAGG + Intergenic
924704945 1:246493200-246493222 TCTCCTCCCCCCCAGTAGCTAGG - Intronic
924755077 1:246933049-246933071 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
924905292 1:248445655-248445677 GATCCTACCTCAGAGAAGCTGGG - Intergenic
1063129864 10:3168993-3169015 GATCCTCTTGCCAAGTAGCTGGG - Intronic
1063846072 10:10128107-10128129 CTTCCTCCTCCCAAGTAGCTGGG - Intergenic
1064057324 10:12108392-12108414 GGCTCACCCTCCAAGTAGCTGGG + Intronic
1064751702 10:18537101-18537123 CCTCGGCCCTCCAAGTAGCTAGG + Intronic
1065007118 10:21390219-21390241 CCTCAGCCCTCCAAGTAGCTAGG + Intergenic
1065517536 10:26539294-26539316 GATCAGCCTCCCAAGTAGCTGGG - Intronic
1065626281 10:27632212-27632234 GCCTCTGCCTCCAAGTAGCTAGG - Intergenic
1065867209 10:29924632-29924654 CATCCTCCCTTCAAATTGCTAGG - Intergenic
1065979165 10:30874262-30874284 GCTCAGCCTTCCAAGTAGCTGGG + Intronic
1066064759 10:31753973-31753995 CCTCCGCCTTCCAAGTAGCTAGG - Intergenic
1066082587 10:31946776-31946798 GCTTCGGCCTCCAAGTAGCTGGG + Intergenic
1066087560 10:31985794-31985816 CCTCCTCCTCCCAAGTAGCTGGG + Intergenic
1066461766 10:35618700-35618722 GAACCTCCCTCTAGGTAGCCAGG + Intergenic
1066474560 10:35732552-35732574 GCTTCAGCCTCCAAGTAGCTGGG + Intergenic
1066632993 10:37474960-37474982 GCTTCACCTTCCAAGTAGCTGGG + Intergenic
1066684334 10:37966296-37966318 GTTCAGCCTTCCAAGTAGCTGGG - Intronic
1067111413 10:43403877-43403899 CCTCATCCCCCCAAGTAGCTGGG - Intronic
1067134729 10:43597739-43597761 CATCAGCCCCCCAAGTAGCTGGG - Intergenic
1067960472 10:50842493-50842515 CCTCCGCCTTCCAAGTAGCTGGG - Intronic
1068004009 10:51371284-51371306 GATCAACCTCCCAAGTAGCTGGG - Intronic
1069008800 10:63348098-63348120 GATCCTCCCACCAAGTAGCTGGG - Intronic
1069441135 10:68429220-68429242 GAACCTTCCACCAAGTAGCTGGG - Intronic
1069812318 10:71171430-71171452 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1069931052 10:71881871-71881893 GATCCTGCCCCCAAGTGGCTGGG + Intergenic
1069974967 10:72205679-72205701 GCTCAGCCTTCCAAGTAGCTGGG - Intronic
1069983511 10:72268560-72268582 CCTCCGCCTTCCAAGTAGCTGGG - Intergenic
1070021023 10:72586127-72586149 GACTCAGCCTCCAAGTAGCTTGG + Intronic
1070038715 10:72753761-72753783 CATCATCCTCCCAAGTAGCTGGG - Intronic
1070073850 10:73116111-73116133 AATTCTCCCACCAAGTAGCTAGG + Intronic
1070182518 10:74028189-74028211 GATCACCCTCCCAAGTAGCTAGG + Intronic
1070227464 10:74524780-74524802 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1070341134 10:75499388-75499410 GACCCTCACTCCAGGCAGCTTGG - Intronic
1070783939 10:79152382-79152404 CCTCAACCCTCCAAGTAGCTGGG - Intronic
1070936229 10:80297994-80298016 TATCAGCCCCCCAAGTAGCTTGG + Intergenic
1071612211 10:87042010-87042032 GCTCAACCTTCCAAGTAGCTGGG + Intergenic
1072475302 10:95754191-95754213 GCCTCTGCCTCCAAGTAGCTGGG - Intronic
1072658372 10:97346673-97346695 CCTCCGCCTTCCAAGTAGCTGGG + Intergenic
1072970931 10:100016748-100016770 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1072997326 10:100256964-100256986 CTGCCTGCCTCCAAGTAGCTGGG - Intronic
1073128794 10:101171494-101171516 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1073209740 10:101789861-101789883 CATCAGCCCTGCAAGTAGCTGGG - Intronic
1073259424 10:102177620-102177642 GATTCTCCTGCCGAGTAGCTGGG - Intergenic
1073525273 10:104175307-104175329 CCTCATCCTTCCAAGTAGCTAGG - Intronic
1075019421 10:118940085-118940107 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1075405257 10:122191229-122191251 GAGTCTGCCTCCACGTAGCTGGG + Intronic
1075824011 10:125338067-125338089 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1076265316 10:129105033-129105055 GATTCTCCTGCCAAGTAGTTTGG + Intergenic
1076488106 10:130837151-130837173 GTTTCTCCCTCCAAGGAGCCTGG + Intergenic
1076847273 10:133075458-133075480 GCTCCTCCCTCCATGCAGCTTGG - Intronic
1077063767 11:629146-629168 CCTCGGCCCTCCAAGTAGCTGGG + Intergenic
1077212194 11:1376284-1376306 CTTCCGCCTTCCAAGTAGCTGGG - Intergenic
1077531701 11:3099950-3099972 GATCTTGGCTCCAAGTAGCTGGG - Intronic
1077913348 11:6593519-6593541 GAAGCTCCCTCCAGGTATCTTGG - Intronic
1078658801 11:13267947-13267969 GCTTCAGCCTCCAAGTAGCTAGG + Intergenic
1079072925 11:17363710-17363732 CCTCCGCCTTCCAAGTAGCTGGG + Intronic
1079161421 11:17998299-17998321 GTTCTGCCTTCCAAGTAGCTGGG - Intronic
1079167850 11:18063564-18063586 CCTCATCCTTCCAAGTAGCTGGG - Intergenic
1079587129 11:22139807-22139829 CCTCCGCCTTCCAAGTAGCTGGG - Intergenic
1082777690 11:57260133-57260155 CCTCATCCCCCCAAGTAGCTGGG + Intergenic
1082849973 11:57755650-57755672 TCTCCAGCCTCCAAGTAGCTGGG + Intronic
1083670779 11:64298923-64298945 CCTCAGCCCTCCAAGTAGCTTGG - Intronic
1083906119 11:65671953-65671975 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1083919924 11:65776993-65777015 CAGCCTGCCTCCGAGTAGCTGGG - Exonic
1084229728 11:67742901-67742923 CCTCATCCCCCCAAGTAGCTGGG - Intergenic
1084581811 11:70028895-70028917 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1084689175 11:70715220-70715242 GGTCCTTCCTCCAAGAACCTAGG - Intronic
1085015438 11:73170810-73170832 CTTCCGCCTTCCAAGTAGCTGGG - Intergenic
1085099350 11:73787437-73787459 AATTCTGTCTCCAAGTAGCTGGG - Exonic
1085101368 11:73803244-73803266 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
1085123538 11:73982467-73982489 GATCCGCCTGCCGAGTAGCTGGG - Intronic
1085309650 11:75508705-75508727 GATCCTCCCTCCGCTTAGATTGG - Intronic
1085595341 11:77803963-77803985 GATCCTCCTGCCAAGTAGGGGGG - Intronic
1086235446 11:84624974-84624996 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
1086394345 11:86398686-86398708 CAGCCTCCCTGGAAGTAGCTGGG + Intronic
1086830376 11:91555119-91555141 TCTCCTGCCTCAAAGTAGCTGGG + Intergenic
1087161328 11:94950727-94950749 CCTCCGCCTTCCAAGTAGCTGGG - Intergenic
1087161382 11:94951086-94951108 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1087283131 11:96234363-96234385 CCTCCTCCTCCCAAGTAGCTGGG - Intronic
1087638110 11:100725980-100726002 GCTCAGCCTTCCAAGTAGCTGGG - Intronic
1087996039 11:104810188-104810210 GACTCTCCTCCCAAGTAGCTGGG - Intergenic
1088470384 11:110183245-110183267 GCTCCTCCCTCCACGTAGACTGG - Intronic
1089131204 11:116213544-116213566 GATTCTCCTGCCAAGTAGCTGGG - Intergenic
1089447961 11:118568769-118568791 GATTCTCCCACCGAGTAGCTGGG + Intronic
1089483987 11:118830570-118830592 CTGCCTCCTTCCAAGTAGCTGGG - Intergenic
1089863576 11:121612023-121612045 GCCCCAGCCTCCAAGTAGCTGGG - Intronic
1089931515 11:122317981-122318003 CCTCCTCCTTCCTAGTAGCTGGG - Intergenic
1090020400 11:123123373-123123395 GATCAGCCTCCCAAGTAGCTGGG + Intronic
1091050297 11:132362226-132362248 TCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1091427475 12:403894-403916 GATCCTCGCACCAAGCAGGTGGG + Intronic
1091429900 12:425044-425066 CCTCATCCTTCCAAGTAGCTGGG + Intronic
1092765953 12:11853069-11853091 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1093064291 12:14640339-14640361 GCTCAGCCTTCCAAGTAGCTGGG - Intronic
1093469836 12:19488902-19488924 GCTTCATCCTCCAAGTAGCTGGG + Intronic
1093483704 12:19630420-19630442 CTTCATCCTTCCAAGTAGCTAGG - Intronic
1093494115 12:19735923-19735945 CATCCTCCCACCAAATAGCTGGG + Intergenic
1093733010 12:22587234-22587256 CAGCCTCCTCCCAAGTAGCTGGG - Intergenic
1093775140 12:23064798-23064820 GGTCCTGCCTTCAAGTAGGTTGG - Intergenic
1094420504 12:30265758-30265780 GACTCTGCCTCCTAGTAGCTAGG - Intergenic
1094529972 12:31265046-31265068 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1094546793 12:31412061-31412083 GATTCAGCCTCCAAGTAGCTGGG + Intronic
1095997376 12:48099694-48099716 GCTTCAGCCTCCAAGTAGCTAGG - Intronic
1096128183 12:49135595-49135617 GCTCAGCCCCCCAAGTAGCTGGG + Intergenic
1096734173 12:53639748-53639770 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1096828694 12:54298389-54298411 CCTCATCCCCCCAAGTAGCTGGG - Intronic
1096881275 12:54674400-54674422 GATCTTCCCGCCAAGTAGCTAGG - Intergenic
1096890070 12:54760633-54760655 CCTCATCCCCCCAAGTAGCTGGG + Intergenic
1097010564 12:55950812-55950834 AATCCTCCTGCCATGTAGCTGGG + Intronic
1097030236 12:56084492-56084514 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1097399803 12:59114849-59114871 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1097577503 12:61413269-61413291 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1097908557 12:64945276-64945298 CCTCCACCTTCCAAGTAGCTAGG - Intergenic
1098206877 12:68120121-68120143 GATGCTTCCTCCAGGCAGCTTGG - Intergenic
1098240881 12:68465774-68465796 GCTCAGCTCTCCAAGTAGCTAGG - Intergenic
1098354112 12:69594018-69594040 CAGCCTCCCCCCAAGTGGCTAGG - Intronic
1098389456 12:69953659-69953681 GATCCTCCCACCAATTAGCTGGG - Intronic
1098454416 12:70656100-70656122 CCTCATCCCCCCAAGTAGCTGGG - Intronic
1098548750 12:71739946-71739968 CAGCCTCCCTCCGAGTAGCTGGG + Intergenic
1099320047 12:81135101-81135123 GATCCTCCCTTCAAATAGGATGG + Intronic
1099333836 12:81328917-81328939 CATCCTCCTCCCAAGTAGCTGGG + Intronic
1099517783 12:83619612-83619634 CCTCCTGCCTCCGAGTAGCTGGG + Intergenic
1099799882 12:87443664-87443686 GCCCCCGCCTCCAAGTAGCTAGG + Intergenic
1100126752 12:91436427-91436449 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1100969410 12:100051803-100051825 GATCCTCTCTCCAAAGTGCTGGG - Intronic
1100972926 12:100091130-100091152 GATTTTCCTCCCAAGTAGCTGGG + Intronic
1100997067 12:100313007-100313029 GATCGGCCTTCCAAGTAGCTGGG - Intronic
1101180493 12:102211473-102211495 GATCAGCCTCCCAAGTAGCTGGG - Intergenic
1101306678 12:103535434-103535456 GAACCTTCCACCAAGTAGCTGGG + Intergenic
1101832025 12:108265564-108265586 GATTCTCCCACCTAGTAGCTAGG + Intergenic
1101872844 12:108579940-108579962 CAGCCTCCCTCAGAGTAGCTGGG - Intergenic
1101918344 12:108913175-108913197 GATTCTCCTCCCAAGTAGCTGGG + Intronic
1101984755 12:109436987-109437009 CATCAGCCCTCCAAGTAGCTGGG - Intronic
1102272382 12:111548835-111548857 CAGCCTCTCCCCAAGTAGCTGGG + Intronic
1102661139 12:114529642-114529664 GATCAGCCTCCCAAGTAGCTGGG - Intergenic
1103134097 12:118492705-118492727 GATCAGCCTCCCAAGTAGCTGGG + Intergenic
1103273733 12:119694686-119694708 CAGCCTCCCCCCGAGTAGCTGGG - Intronic
1103540194 12:121660782-121660804 CCTCATCCCCCCAAGTAGCTGGG + Intronic
1103557009 12:121772538-121772560 GATTCTCCTGCCAAGTAGCTGGG + Intronic
1103589386 12:121980462-121980484 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1103666006 12:122566357-122566379 GATTCTCCTGCCCAGTAGCTGGG + Intronic
1103687274 12:122741993-122742015 GCTCAGCCTTCCAAGTAGCTGGG - Intergenic
1103770019 12:123314719-123314741 CCTCCGCCTTCCAAGTAGCTGGG + Intronic
1103849427 12:123922255-123922277 CAGCCTCCCCCCCAGTAGCTGGG - Intronic
1104296655 12:127521568-127521590 GCTTCAGCCTCCAAGTAGCTGGG + Intergenic
1104458409 12:128934307-128934329 GATTCTCCTTCCAAGTAGCTGGG + Intronic
1104559813 12:129833507-129833529 CCTCCTCCTCCCAAGTAGCTGGG - Intronic
1105065742 12:133195831-133195853 CCTCCCCCTTCCAAGTAGCTGGG + Intronic
1105392378 13:19992449-19992471 CCTCCCACCTCCAAGTAGCTGGG - Intronic
1105399441 13:20075798-20075820 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
1106233860 13:27844814-27844836 CAGCCTCCTCCCAAGTAGCTGGG - Intergenic
1106417253 13:29556492-29556514 CATCAGCCCCCCAAGTAGCTGGG + Intronic
1106644344 13:31616524-31616546 CCTCCGCCTTCCAAGTAGCTAGG - Intergenic
1106763960 13:32895217-32895239 GATCCTCTCTCCAAAGAGCGGGG - Intergenic
1107303032 13:38986148-38986170 TCTCCTCCCTCCCAGTAGCAGGG + Intronic
1107324629 13:39228415-39228437 GATCCTCCTCCCAAGTAGCTAGG + Intergenic
1107754640 13:43606900-43606922 GGTACTCCCCCTAAGTAGCTGGG - Intronic
1108022045 13:46137419-46137441 CAGCCTCCCACCAAATAGCTGGG - Intronic
1110209086 13:72951815-72951837 CATCAGCCTTCCAAGTAGCTGGG + Intronic
1110903858 13:80860868-80860890 CACCTTCCCTCCCAGTAGCTGGG + Intergenic
1110941700 13:81359118-81359140 GATTCTCCACCCGAGTAGCTGGG - Intergenic
1111437266 13:88226743-88226765 TCTCGACCCTCCAAGTAGCTGGG + Intergenic
1112632948 13:101181621-101181643 CAGCCTCCTCCCAAGTAGCTGGG - Intronic
1112953148 13:105027770-105027792 GATCCACCCTCAATGTAGGTGGG + Intergenic
1113289579 13:108890045-108890067 CCTCATCCTTCCAAGTAGCTGGG + Intronic
1114202847 14:20539047-20539069 CCTCATCCTTCCAAGTAGCTGGG + Intergenic
1114552347 14:23540104-23540126 CAGCCTCCCTCCCAGTAGCTGGG + Intronic
1114633787 14:24176170-24176192 AATTCTCCTTCCTAGTAGCTGGG + Intronic
1115288363 14:31742717-31742739 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1115604373 14:34985214-34985236 CATTATCCCTCCAACTAGCTGGG - Intronic
1115662295 14:35508586-35508608 CATCAGCCTTCCAAGTAGCTAGG - Intergenic
1116399143 14:44483835-44483857 GTTCCCCCTCCCAAGTAGCTGGG - Intergenic
1117163847 14:53014956-53014978 GCTTCAGCCTCCAAGTAGCTGGG + Intergenic
1117209831 14:53484003-53484025 ACCCCACCCTCCAAGTAGCTGGG + Intergenic
1117393944 14:55290275-55290297 GCCTCTGCCTCCAAGTAGCTGGG - Intronic
1118351826 14:64977557-64977579 TCTCATCCTTCCAAGTAGCTGGG - Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119312877 14:73664753-73664775 AATCCTCCTCCTAAGTAGCTGGG - Intronic
1119627396 14:76191071-76191093 GACCCTCCCTACAAGTAGAAAGG - Intronic
1119630982 14:76232025-76232047 CTTCAGCCCTCCAAGTAGCTGGG + Intronic
1119655823 14:76416250-76416272 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1119817943 14:77587649-77587671 GATCAGCCTTCCGAGTAGCTGGG - Intronic
1119881341 14:78102255-78102277 GGACCCCCCTCCAAATAGCTGGG + Intergenic
1120191209 14:81441477-81441499 CATCAGCCCCCCAAGTAGCTGGG + Intergenic
1120520490 14:85522273-85522295 GATTCTCCTGCCGAGTAGCTGGG + Intergenic
1120585207 14:86304016-86304038 CAGCCTCCCCCCGAGTAGCTGGG + Intergenic
1120802176 14:88702868-88702890 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1120934914 14:89885560-89885582 GCCCCAGCCTCCAAGTAGCTGGG - Intronic
1121528531 14:94637124-94637146 GTTCTTGCCTCCAAGGAGCTTGG - Intergenic
1121588544 14:95081407-95081429 GCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1121780623 14:96619580-96619602 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1122268796 14:100559080-100559102 GATGCTCACACCAAGGAGCTCGG + Intronic
1122449703 14:101795936-101795958 GCTCAGCCTTCCAAGTAGCTGGG + Intronic
1122465639 14:101931775-101931797 GATCCTCCTCCCAAGTAGCTGGG + Intergenic
1122483238 14:102061214-102061236 TCTCCTGCCTCCAAGGAGCTGGG - Intergenic
1122926031 14:104900877-104900899 CCTCCTCCCTCAGAGTAGCTGGG - Intergenic
1123789837 15:23709674-23709696 CCTCAGCCCTCCAAGTAGCTAGG + Intergenic
1124015500 15:25870796-25870818 TCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1124596827 15:31098322-31098344 GATTCTCCTGCCAACTAGCTGGG - Intronic
1126010144 15:44294787-44294809 GATACTCCTCCCAAGTAGCTGGG - Intronic
1126055369 15:44725114-44725136 CCTCCGCCTTCCAAGTAGCTGGG - Intergenic
1126482356 15:49140100-49140122 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1126630390 15:50728927-50728949 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1126713662 15:51489539-51489561 CAACCAGCCTCCAAGTAGCTGGG - Intronic
1127594322 15:60463655-60463677 CTTCCGCCTTCCAAGTAGCTGGG - Intronic
1127949282 15:63788799-63788821 GCCCCAGCCTCCAAGTAGCTGGG - Intronic
1127981795 15:64040793-64040815 CAGCCTCCTCCCAAGTAGCTGGG - Intronic
1128205959 15:65852242-65852264 CATCATCCTCCCAAGTAGCTGGG + Intronic
1128983843 15:72205236-72205258 CACCCCCTCTCCAAGTAGCTGGG + Intronic
1129036443 15:72652336-72652358 CATCAGCCTTCCAAGTAGCTAGG + Intergenic
1129213446 15:74084889-74084911 CATCAGCCTTCCAAGTAGCTAGG - Intergenic
1129320983 15:74774762-74774784 CAGCCTCCCAGCAAGTAGCTGGG - Intergenic
1129347849 15:74935482-74935504 CCTCCACCTTCCAAGTAGCTGGG - Intronic
1129396956 15:75256197-75256219 CATCAGCCTTCCAAGTAGCTAGG + Intergenic
1129400568 15:75280474-75280496 CATCAGCCTTCCAAGTAGCTAGG + Intronic
1129422895 15:75443600-75443622 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1129860067 15:78853866-78853888 GTGCCTCCACCCAAGTAGCTGGG + Intronic
1129955661 15:79634527-79634549 TCTCATCCTTCCAAGTAGCTGGG - Intergenic
1130120202 15:81041421-81041443 GCTTCAGCCTCCAAGTAGCTGGG + Intronic
1130307361 15:82722352-82722374 TCTCCTGCCTCAAAGTAGCTGGG - Intergenic
1131249546 15:90821254-90821276 GATTCTCCTGCCAGGTAGCTGGG + Intergenic
1131763670 15:95651881-95651903 CATCAGCCTTCCAAGTAGCTAGG - Intergenic
1132077802 15:98837355-98837377 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
1133033998 16:3024748-3024770 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1133252442 16:4492216-4492238 ATTCATCCTTCCAAGTAGCTAGG - Intronic
1133426677 16:5697647-5697669 CCTCAGCCCTCCAAGTAGCTAGG + Intergenic
1133626825 16:7577781-7577803 CATCAGCCTTCCAAGTAGCTAGG - Intronic
1133767103 16:8845682-8845704 GATTCTCCTGCCAAGCAGCTGGG + Intronic
1134124610 16:11607962-11607984 GATCCTGCCTTCAGGGAGCTGGG - Intronic
1134475313 16:14568488-14568510 GCTCCACCCTCCAAGTAGCAGGG - Intronic
1135110227 16:19684940-19684962 CATCAGCCATCCAAGTAGCTGGG - Intronic
1135592455 16:23714043-23714065 AATCCTCCTCCCGAGTAGCTGGG + Intergenic
1135764586 16:25166514-25166536 GGTCATCCTCCCAAGTAGCTGGG + Intronic
1136137476 16:28265467-28265489 TAGCCTCCTCCCAAGTAGCTAGG - Intergenic
1136509465 16:30727500-30727522 TCTCAGCCCTCCAAGTAGCTGGG + Intronic
1138169353 16:54834325-54834347 CAGCCTCCCACCGAGTAGCTGGG - Intergenic
1138510321 16:57504995-57505017 GATTCTCCTGCCTAGTAGCTAGG + Intergenic
1139418827 16:66835670-66835692 GATCCTCCCACCAAGTAGCTGGG - Intronic
1139459695 16:67111737-67111759 CAGCCTCCCTACTAGTAGCTGGG + Intronic
1139670025 16:68486303-68486325 GCCCCAGCCTCCAAGTAGCTGGG + Intergenic
1139679949 16:68553732-68553754 CCTCAGCCCTCCAAGTAGCTAGG + Intronic
1139780398 16:69346646-69346668 TCTCCTCCTCCCAAGTAGCTGGG - Intronic
1139782874 16:69366229-69366251 GATCCTCCCTCCAGGCAGACTGG - Intronic
1139788958 16:69416829-69416851 GCCCCAGCCTCCAAGTAGCTGGG - Intergenic
1140203017 16:72909760-72909782 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1140434888 16:74938650-74938672 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1140715807 16:77724375-77724397 CTTCCGCCTTCCAAGTAGCTGGG + Intronic
1141113542 16:81289523-81289545 CTTCAGCCCTCCAAGTAGCTGGG - Intronic
1141442658 16:84039628-84039650 CAGCCTCCTCCCAAGTAGCTGGG - Intronic
1142243929 16:88959908-88959930 CAGCCTCCTGCCAAGTAGCTGGG - Intronic
1142639084 17:1275066-1275088 CAGCCTCCTCCCAAGTAGCTGGG - Intergenic
1142784404 17:2209316-2209338 GATCAGCCTCCCAAGTAGCTGGG + Intronic
1143070694 17:4290585-4290607 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1143093757 17:4465609-4465631 CATCAGCCTTCCAAGTAGCTGGG - Intronic
1143099085 17:4495329-4495351 AATTCTCCTCCCAAGTAGCTGGG + Intergenic
1143253455 17:5538984-5539006 GATTCTCCCTGCAAGTAGCTGGG + Intronic
1143425106 17:6829596-6829618 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1144449808 17:15367278-15367300 GCTCAGCCCCCCAAGTAGCTGGG + Intergenic
1144577973 17:16441677-16441699 AATCCTCCCACCTTGTAGCTGGG + Intronic
1144805127 17:17960450-17960472 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
1144939133 17:18925002-18925024 GATCAGCCTCCCAAGTAGCTGGG - Intronic
1144962179 17:19050931-19050953 GATTCTATTTCCAAGTAGCTGGG - Intergenic
1144972982 17:19123590-19123612 GATTCTATTTCCAAGTAGCTGGG + Intergenic
1145751871 17:27361124-27361146 GATCCTCCTGCCAAGTAGCTGGG - Intergenic
1146039922 17:29442159-29442181 CAACCTCCTCCCAAGTAGCTGGG + Intronic
1146327075 17:31895913-31895935 GATCAGCCTCCCAAGTAGCTGGG - Intronic
1146600365 17:34209333-34209355 TATCCACCCTCCATGTAGGTGGG - Intergenic
1146695459 17:34906054-34906076 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1146817189 17:35952229-35952251 GTTTCAGCCTCCAAGTAGCTGGG + Intergenic
1147202564 17:38813008-38813030 TCTCCTCCTCCCAAGTAGCTGGG - Intronic
1147236159 17:39059070-39059092 CCTCCGCCTTCCAAGTAGCTGGG - Intergenic
1147355983 17:39897120-39897142 CCTCCTGCCTCCAAGAAGCTGGG + Intergenic
1147409450 17:40238981-40239003 CCTCCTACCTCCAAGTAGCTGGG + Intronic
1148432801 17:47656136-47656158 GCTCCCCCCAGCAAGTAGCTGGG - Intronic
1148485159 17:47986167-47986189 GATTCTCCTGCCGAGTAGCTGGG - Intergenic
1148602623 17:48905958-48905980 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1148616529 17:49004485-49004507 GTTCCTCTCTCCCAGTAGCTGGG + Intronic
1148682163 17:49480551-49480573 GCTCCTGCCTTCAAGGAGCTTGG - Intergenic
1148827887 17:50407684-50407706 GCTTCAGCCTCCAAGTAGCTGGG + Intergenic
1149057469 17:52382950-52382972 CCTCATCCCCCCAAGTAGCTGGG - Intergenic
1149586697 17:57793396-57793418 GCTCAGCCATCCAAGTAGCTGGG - Intergenic
1149680082 17:58500240-58500262 CGTCAGCCCTCCAAGTAGCTGGG + Intronic
1150090594 17:62321520-62321542 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1150113303 17:62521049-62521071 CCTCCGACCTCCAAGTAGCTGGG - Intronic
1150490047 17:65568145-65568167 GCTCACCCTTCCAAGTAGCTGGG - Intronic
1150917320 17:69450048-69450070 CATCAGCCTTCCAAGTAGCTGGG + Intronic
1151168671 17:72226910-72226932 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1151498905 17:74476305-74476327 GAGCCTCCCTCCTAAGAGCTAGG + Intronic
1151649664 17:75458573-75458595 CATCCACCTCCCAAGTAGCTGGG - Intronic
1152517326 17:80833303-80833325 GCTCCTCCCCCCCAGCAGCTGGG - Intronic
1153241711 18:3036995-3037017 TCTCCTGCCTCCGAGTAGCTGGG + Intergenic
1153375897 18:4378767-4378789 GATCTTCCCTCCTAACAGCTTGG + Intronic
1153694265 18:7624589-7624611 GATCCTTCTCCCAAGTAGCTGGG + Intronic
1153801534 18:8675429-8675451 GATTCAGCCTCCGAGTAGCTGGG + Intergenic
1153875401 18:9365888-9365910 TCTCAGCCCTCCAAGTAGCTAGG - Intronic
1154276875 18:12969311-12969333 AATCCTCCTCCCAAGTAGCTGGG - Intronic
1155136698 18:23002290-23002312 GCTCCAGCCCCCAAGTAGCTGGG - Intronic
1155480217 18:26278417-26278439 ACTTCACCCTCCAAGTAGCTAGG + Intronic
1155501666 18:26492515-26492537 CATCCTCCCACTGAGTAGCTGGG - Intronic
1155550639 18:26961542-26961564 AATTCAGCCTCCAAGTAGCTGGG + Intronic
1155625311 18:27827902-27827924 CCTCCGCCTTCCAAGTAGCTAGG + Intergenic
1156311932 18:35931658-35931680 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1157324719 18:46660424-46660446 GATCCTCACACCAAGGAGCTGGG - Intergenic
1157545063 18:48540858-48540880 GGTCCCCTCTCCAAGTAACTCGG - Intronic
1157811549 18:50700666-50700688 GCACCTCCCTCCAAGTGTCTGGG + Intronic
1158490421 18:57905389-57905411 GCCTCTGCCTCCAAGTAGCTAGG + Intergenic
1158604613 18:58884263-58884285 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1158719491 18:59911406-59911428 CCTCATCCCACCAAGTAGCTGGG - Intergenic
1159147917 18:64478738-64478760 GCTCAGCCTTCCAAGTAGCTGGG + Intergenic
1159905453 18:74086524-74086546 GTTCAGCCCCCCAAGTAGCTGGG + Intronic
1159923211 18:74245319-74245341 GATTCTCCTCCCGAGTAGCTGGG + Intergenic
1160611487 18:80090745-80090767 ACTCCTCCTGCCAAGTAGCTGGG - Intronic
1160920466 19:1517490-1517512 GATCAGCCTCCCAAGTAGCTCGG + Intergenic
1160958105 19:1704119-1704141 CATTCTCCTCCCAAGTAGCTGGG - Intergenic
1161130008 19:2582596-2582618 GCTCCACCTTCCAAGTAGCTGGG + Intronic
1161444951 19:4313011-4313033 GATTCACCCTCCAAGTATTTGGG + Intronic
1161757057 19:6141847-6141869 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1161758691 19:6154280-6154302 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1161784495 19:6315317-6315339 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1161903031 19:7133745-7133767 GTCTCACCCTCCAAGTAGCTGGG - Intronic
1161923153 19:7281563-7281585 CTTCCTCCTCCCAAGTAGCTGGG - Intronic
1162010558 19:7811300-7811322 CCTCCTCCCCCCAAGTAGCTGGG + Intergenic
1162224895 19:9212866-9212888 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1162469876 19:10866304-10866326 GATTCTCCTGCCGAGTAGCTGGG + Intronic
1162522308 19:11188866-11188888 CCTCCACCTTCCAAGTAGCTGGG - Intronic
1162672474 19:12268687-12268709 TATCCTCCCACCCAGTAACTGGG + Intronic
1162905602 19:13821663-13821685 AAGCCTCCCACCAAGTAACTGGG + Intronic
1163009481 19:14415955-14415977 TCTCCTGCCTCCAAGTAGCTGGG - Intronic
1163360407 19:16842520-16842542 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1163396064 19:17062245-17062267 CACCCTCACCCCAAGTAGCTGGG + Intronic
1163406290 19:17125183-17125205 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1163463118 19:17450903-17450925 CAGCCTCTCCCCAAGTAGCTGGG + Intronic
1163512329 19:17742808-17742830 CCTCATCCTTCCAAGTAGCTGGG + Intergenic
1164037149 19:21465288-21465310 GCCTCACCCTCCAAGTAGCTGGG - Intronic
1164180937 19:22818103-22818125 CATCATCTCTCCAAGTAACTGGG - Intergenic
1164221478 19:23198097-23198119 AATTCTCCTGCCAAGTAGCTGGG - Intergenic
1164942630 19:32263450-32263472 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1165073262 19:33267733-33267755 GGCCCTGCCTCCAAGTAGCCTGG + Intergenic
1165243817 19:34486481-34486503 GCTCAGCCTTCCAAGTAGCTGGG + Intronic
1165376060 19:35443016-35443038 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1165750196 19:38254897-38254919 GATTCTCCTCCCGAGTAGCTGGG + Intronic
1165945422 19:39439019-39439041 CATCAGCCTTCCAAGTAGCTGGG + Intronic
1166092956 19:40522140-40522162 CGTCAGCCCTCCAAGTAGCTGGG + Intronic
1166256772 19:41612229-41612251 GATTCTCCACCCAAGTAGCTGGG + Intronic
1166309260 19:41953306-41953328 CATCCTCCCGCTGAGTAGCTGGG + Intergenic
1166614495 19:44230987-44231009 GATGCTCCTCCCAAGTAGCTGGG - Intronic
1166734039 19:45074243-45074265 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1166742079 19:45120726-45120748 GATTCTCCTCCCAAGTAGCTGGG + Intronic
1167173280 19:47848087-47848109 CCTCTGCCCTCCAAGTAGCTGGG - Intergenic
1167173652 19:47850469-47850491 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1167610270 19:50504244-50504266 CCTCCACCCCCCAAGTAGCTGGG + Intergenic
1167672921 19:50865522-50865544 CATCAGCCTTCCAAGTAGCTGGG + Intronic
1167847997 19:52180077-52180099 AATTCTCCTGCCAAGTAGCTGGG - Intergenic
1167921105 19:52783956-52783978 GATACTTCCCCCGAGTAGCTGGG - Intronic
1168121393 19:54254243-54254265 GAGCTTCCCTCCAGGGAGCTGGG - Intronic
1168209745 19:54881754-54881776 CATCCTCCTCCCGAGTAGCTGGG - Intronic
1168231025 19:55031855-55031877 CCTCAGCCCTCCAAGTAGCTAGG - Intronic
1168233319 19:55046780-55046802 TCTCCTGTCTCCAAGTAGCTGGG - Intronic
1168285699 19:55331616-55331638 GCTCATCCTCCCAAGTAGCTGGG + Intronic
1168666012 19:58205451-58205473 CCTCCTGCCTCCAAGTAGCTAGG + Intronic
925938207 2:8788382-8788404 CTTCATCCTTCCAAGTAGCTAGG + Intronic
925941470 2:8824562-8824584 CTTCAGCCCTCCAAGTAGCTAGG - Intronic
926276262 2:11405369-11405391 AATTCTCCTGCCAAGTAGCTGGG - Intergenic
926590556 2:14735620-14735642 GATTCTCCTCCCAAGTAGCTGGG - Intergenic
926741848 2:16117890-16117912 GCTCAGCCTTCCAAGTAGCTGGG + Intergenic
927549550 2:23985881-23985903 AATTCTCCTCCCAAGTAGCTGGG - Intronic
927557921 2:24049248-24049270 CAGCCTCCACCCAAGTAGCTGGG - Intronic
927769111 2:25842935-25842957 CATCAGCCATCCAAGTAGCTGGG + Intronic
927813848 2:26196696-26196718 GTTCTGCCCTCCAAGTATCTAGG - Intronic
927834917 2:26387578-26387600 CCTCAGCCCTCCAAGTAGCTAGG - Intronic
927860808 2:26558937-26558959 GAGCCTCCCTTCCAGGAGCTGGG - Intergenic
927905410 2:26851827-26851849 CAGCCTCCTCCCAAGTAGCTGGG - Intronic
928289336 2:30023897-30023919 GCTCCGCCTCCCAAGTAGCTGGG - Intergenic
929144707 2:38696545-38696567 GCTCCGCCTTCCAAATAGCTAGG + Intronic
929630364 2:43453992-43454014 GCTCAACCTTCCAAGTAGCTAGG + Intronic
929708285 2:44239057-44239079 GCTTCAGCCTCCAAGTAGCTAGG - Intronic
930153737 2:48083908-48083930 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
930426770 2:51222694-51222716 GATTCTCCTGCCAAGTAGCTGGG + Intergenic
930641936 2:53862226-53862248 CATCAGCCCCCCAAGTAGCTGGG + Intergenic
930651141 2:53966167-53966189 GTCTCTGCCTCCAAGTAGCTGGG - Intronic
931240668 2:60449620-60449642 TCTCCTCCATCCAAGTGGCTGGG + Intergenic
931326677 2:61232973-61232995 GATTCTCCTCCCGAGTAGCTGGG + Intronic
931484946 2:62681195-62681217 TCTCCTGCCTCCGAGTAGCTGGG - Intronic
931559291 2:63540857-63540879 GATCCTCCCTCCAAGTAGCTGGG + Intronic
931667495 2:64620334-64620356 AATCCTCTCACCAAGTAACTGGG - Intergenic
931686591 2:64799449-64799471 AGTCCTCCCACCAGGTAGCTGGG + Intergenic
931953718 2:67394955-67394977 GATTCTCCTTCCTAGTAGCTGGG + Intergenic
932175577 2:69597764-69597786 GATCCTCCCAGCTAGTAGCTGGG - Intronic
932208228 2:69903059-69903081 TAGCCTTCCGCCAAGTAGCTGGG + Intronic
932266715 2:70373889-70373911 CAGCCTCCTCCCAAGTAGCTGGG - Intergenic
932339947 2:70957199-70957221 CCTCATCCTTCCAAGTAGCTGGG + Intronic
932992616 2:76806463-76806485 CATCAGCCTTCCAAGTAGCTGGG - Intronic
933691127 2:85180401-85180423 GACACACCCTCCAGGTAGCTGGG - Intronic
933801385 2:85962955-85962977 CATCAGCCCTGCAAGTAGCTGGG + Intergenic
933818716 2:86090277-86090299 CATCATCCTACCAAGTAGCTGGG - Intronic
933866989 2:86528907-86528929 CATCCTCCCTCCAAACATCTAGG + Intronic
934562872 2:95322246-95322268 CATGTTCCCTGCAAGTAGCTAGG - Intronic
934741591 2:96727514-96727536 CAGCCTCCTTCCCAGTAGCTGGG - Intronic
934895533 2:98116620-98116642 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
935095009 2:99935871-99935893 GTTCCTTCCTCCATGTCGCTGGG - Intronic
936681888 2:114783716-114783738 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
936764271 2:115826603-115826625 CCTCATCCTTCCAAGTAGCTGGG - Intronic
937106666 2:119322320-119322342 CATCAACCCCCCAAGTAGCTGGG + Intronic
937163058 2:119784331-119784353 TAACCTACCACCAAGTAGCTGGG + Intronic
937371125 2:121298078-121298100 CCTCATCCCCCCAAGTAGCTGGG - Intergenic
937677424 2:124607516-124607538 CATCCTCCCTCCAAGTGGGCTGG - Intronic
938172812 2:129096566-129096588 GATTCTCTTGCCAAGTAGCTGGG + Intergenic
939076831 2:137612949-137612971 GCTCTTCCTTCCAAGTAGCTGGG - Intronic
939130986 2:138236156-138236178 TATCAGCCTTCCAAGTAGCTGGG - Intergenic
939917365 2:148064229-148064251 CATTCTCCCGCCTAGTAGCTGGG + Intronic
940230687 2:151448157-151448179 GATTCTCCTCCCTAGTAGCTGGG + Intronic
940294637 2:152109871-152109893 TAGCCTCCCTGCAAGTAGCTGGG + Intergenic
940296534 2:152130879-152130901 GCTCATCCTCCCAAGTAGCTAGG - Intronic
940909150 2:159195233-159195255 GCTTCAGCCTCCAAGTAGCTGGG + Intronic
940914188 2:159236739-159236761 GCTCCACCTCCCAAGTAGCTGGG + Intronic
940984675 2:160040683-160040705 GATCCTCCCTTTAAGGAACTTGG - Intronic
941931587 2:170946125-170946147 GCTCAGCCTTCCAAGTAGCTGGG + Intronic
942547922 2:177083989-177084011 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
942614910 2:177781615-177781637 GACTCAGCCTCCAAGTAGCTGGG + Intronic
943315046 2:186376393-186376415 CAGCCTCCCTACAAGTAGCTGGG - Intergenic
944140461 2:196450595-196450617 GATTCTCCTGCCAAGTAGCTAGG + Intronic
944588886 2:201198654-201198676 CCTCATCCTTCCAAGTAGCTGGG + Intronic
944643308 2:201750966-201750988 GCTCAGCCTTCCAAGTAGCTAGG + Intronic
944872079 2:203922595-203922617 GTTCATCCTTCCAAGCAGCTAGG + Intergenic
945205537 2:207327882-207327904 AATCCTCTCTCCTAGTAGCATGG + Intergenic
945231667 2:207596547-207596569 GCTCAGCCTTCCAAGTAGCTGGG + Intronic
945321903 2:208434196-208434218 GTTCATCCTCCCAAGTAGCTGGG - Intronic
945478871 2:210321160-210321182 CAGCCTCCCTTCAAGTAGCTGGG - Intergenic
945944339 2:215980456-215980478 GAGCCTCCCTCGAAGCTGCTTGG - Intronic
946232587 2:218301669-218301691 CCTCATCCTTCCAAGTAGCTGGG - Intronic
946266171 2:218543698-218543720 CATTCTCCTGCCAAGTAGCTGGG - Intronic
946678323 2:222186198-222186220 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
947625588 2:231616207-231616229 GATTCTCCTGCCAAGTAGCTGGG - Intergenic
948123686 2:235549404-235549426 CAGCATCTCTCCAAGTAGCTGGG - Intronic
948498998 2:238377341-238377363 CTTCCTCCTCCCAAGTAGCTGGG + Intronic
948719146 2:239886034-239886056 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1168908461 20:1425884-1425906 CCTCATCCATCCAAGTAGCTGGG + Intergenic
1168909215 20:1433346-1433368 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1169079633 20:2788878-2788900 GCTCCTCCTCCCACGTAGCTAGG + Intergenic
1169169269 20:3451261-3451283 GATCTTCCTCCCAAGTTGCTGGG + Intergenic
1169239391 20:3962814-3962836 GATTCTCCTGCCAAGTAGCTGGG + Intronic
1169443270 20:5650883-5650905 GCTTCAGCCTCCAAGTAGCTGGG + Intergenic
1170654748 20:18276070-18276092 CCTCCACCTTCCAAGTAGCTGGG - Intergenic
1171318416 20:24216769-24216791 CCTCAACCCTCCAAGTAGCTGGG - Intergenic
1172231326 20:33338324-33338346 CCTCATCCCCCCAAGTAGCTGGG - Intergenic
1172450387 20:35018478-35018500 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1172542386 20:35728958-35728980 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1172551132 20:35800939-35800961 GCTCTGCCTTCCAAGTAGCTGGG + Intronic
1172674931 20:36662331-36662353 AATTCTCTCGCCAAGTAGCTGGG + Intronic
1173382720 20:42560627-42560649 AATGCTCTCTGCAAGTAGCTGGG + Intronic
1174216321 20:48919426-48919448 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1174227826 20:49018349-49018371 CAGCCTCCCGCCAAGTAGCTGGG + Intronic
1174489325 20:50881115-50881137 CCACCTCCCACCAAGTAGCTGGG - Intronic
1174514287 20:51079421-51079443 GCTCCGCCTCCCAAGTAGCTGGG - Intergenic
1174614318 20:51824243-51824265 TCTCCTGCCTCCCAGTAGCTGGG - Intergenic
1175076127 20:56375241-56375263 CAGCCTCCTTCCGAGTAGCTGGG + Intronic
1175233931 20:57495726-57495748 CCTCCGCCCCCCAAGTAGCTGGG + Intergenic
1175522368 20:59610137-59610159 GCTCAGCCCCCCAAGTAGCTGGG - Intronic
1176887681 21:14275422-14275444 CAGCCCCCCACCAAGTAGCTGGG - Intergenic
1177679929 21:24353741-24353763 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1178069043 21:28940969-28940991 GATCTTCTCACTAAGTAGCTGGG - Intronic
1178145563 21:29735779-29735801 GATCAGCCTCCCAAGTAGCTGGG - Intronic
1178909862 21:36665834-36665856 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1179024745 21:37670647-37670669 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1179469452 21:41600957-41600979 GATCCGCCTCCCGAGTAGCTGGG - Intergenic
1179542903 21:42095208-42095230 GCTCAGCCCCCCAAGTAGCTGGG + Intronic
1179559531 21:42205481-42205503 GCTTCAGCCTCCAAGTAGCTGGG - Intronic
1180666232 22:17514915-17514937 CATTCTCCTCCCAAGTAGCTGGG - Intronic
1180691606 22:17721049-17721071 CAGCCTCCCCCCGAGTAGCTGGG - Intronic
1180848912 22:19001346-19001368 CTTCAGCCCTCCAAGTAGCTGGG - Intergenic
1180936061 22:19625962-19625984 GAACCTCCCTCCAAGACTCTTGG - Intergenic
1180966356 22:19789728-19789750 GATCCTCCTCCCGAGTAGTTGGG - Intronic
1181385485 22:22542338-22542360 GATCTGCCCTCCATGTAGGTGGG - Intergenic
1181551711 22:23642883-23642905 GCTTCAGCCTCCAAGTAGCTGGG + Intergenic
1181614710 22:24045503-24045525 GGTGATCCTTCCAAGTAGCTGGG - Intronic
1181664104 22:24379263-24379285 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1182161584 22:28127841-28127863 CAGCCCCTCTCCAAGTAGCTGGG + Intronic
1182215735 22:28715979-28716001 CCTCCACCTTCCAAGTAGCTGGG + Intronic
1182278995 22:29207355-29207377 GAGCATACCTCCAAGCAGCTGGG - Intronic
1182382414 22:29903108-29903130 GCCTCACCCTCCAAGTAGCTGGG - Intronic
1182602294 22:31475634-31475656 CAGCCTCCCTACAGGTAGCTGGG - Intronic
1182796204 22:32993459-32993481 GATTCTCCTCCCGAGTAGCTGGG + Intronic
1183202550 22:36395713-36395735 GATTCTCCTACCTAGTAGCTGGG + Intergenic
1184577033 22:45377952-45377974 GTTCCTCCTGCCAAGTAGCTGGG + Intronic
1184752474 22:46495698-46495720 GACTCAGCCTCCAAGTAGCTGGG - Intronic
1185396512 22:50593832-50593854 CCTCGTCCTTCCAAGTAGCTGGG - Intronic
949792420 3:7807726-7807748 CATCTTCCGTCAAAGTAGCTGGG + Intergenic
950390704 3:12694338-12694360 TCTCCTCCCTCCAAGTAAATAGG - Intergenic
950509672 3:13418841-13418863 GATTCTCCCGCCTCGTAGCTGGG - Intronic
950644550 3:14369309-14369331 GAGCCCCCCTCCAAGAAACTGGG - Intergenic
951510416 3:23494885-23494907 GATACTCCTCCCGAGTAGCTGGG + Intronic
951727925 3:25781063-25781085 CCTCTGCCCTCCAAGTAGCTGGG + Intronic
951930643 3:27963323-27963345 GGCTCACCCTCCAAGTAGCTGGG + Intergenic
952109427 3:30105457-30105479 CCTCCTTCTTCCAAGTAGCTGGG - Intergenic
952315350 3:32227616-32227638 CATCAGCCTTCCAAGTAGCTAGG + Intergenic
953013138 3:39047183-39047205 TATCAGCCTTCCAAGTAGCTGGG + Intergenic
953498560 3:43410367-43410389 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
953518256 3:43618056-43618078 GAGCCTCCCTCCTTGTACCTAGG + Intronic
953709010 3:45253895-45253917 GACTCAGCCTCCAAGTAGCTGGG + Intergenic
953743966 3:45559018-45559040 GAGCCTCCTCCCAAGTAGCTGGG - Intronic
954031454 3:47822975-47822997 GCTCAGCCCCCCAAGTAGCTGGG - Intronic
956235234 3:67062591-67062613 CATCAGCCTTCCAAGTAGCTAGG + Intergenic
956826433 3:73001456-73001478 CCTCCTCCTCCCAAGTAGCTGGG - Intronic
957687532 3:83521808-83521830 TACCCCCCATCCAAGTAGCTGGG + Intergenic
958027973 3:88071528-88071550 CATTCTCCTGCCAAGTAGCTGGG - Intronic
958672002 3:97218153-97218175 CATCAGCCTTCCAAGTAGCTGGG - Intronic
959381510 3:105646298-105646320 CCTCATCCTTCCAAGTAGCTGGG - Intergenic
959697892 3:109269162-109269184 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
959706319 3:109341623-109341645 CCTCCGCCTTCCAAGTAGCTGGG - Intergenic
960119509 3:113932998-113933020 CAGCCTCCCACCGAGTAGCTGGG + Intronic
960683066 3:120269042-120269064 AATCCTCCAGCTAAGTAGCTGGG + Intronic
960718152 3:120598166-120598188 CCTCCGCCTTCCAAGTAGCTGGG + Intronic
961118815 3:124355829-124355851 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
961158713 3:124703767-124703789 GATCAGTCTTCCAAGTAGCTGGG + Intronic
961417791 3:126773719-126773741 TCTCATCCTTCCAAGTAGCTGGG + Intronic
961443675 3:126967830-126967852 TCTCATCCTTCCAAGTAGCTGGG + Intergenic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
962038142 3:131676172-131676194 CAGCCTCCTTCCTAGTAGCTGGG + Intronic
962198807 3:133384828-133384850 CATCCTCCCTGCAAGAAGATGGG + Intronic
962605199 3:137026974-137026996 CATGCTCCCTCCATGTAGCTGGG + Intergenic
963365307 3:144326270-144326292 GATCAGCCTCCCAAGTAGCTGGG - Intergenic
964331966 3:155612790-155612812 TCTCAGCCCTCCAAGTAGCTGGG - Intronic
964487318 3:157199292-157199314 GCTCAGCCTTCCAAGTAGCTGGG - Intergenic
964498252 3:157318490-157318512 GCTCTGCCCCCCAAGTAGCTGGG - Intronic
965196146 3:165597839-165597861 GCTCCAGCCTCCGAGTAGCTGGG + Intergenic
965805917 3:172541612-172541634 CTTCAGCCCTCCAAGTAGCTGGG - Intergenic
966394722 3:179490749-179490771 GATCCACCCTCAAAGTAGGTAGG - Intergenic
966704846 3:182901065-182901087 GATTCTCCTCCCAAGTAGCTGGG - Intronic
967111764 3:186299951-186299973 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
967562456 3:190932922-190932944 GTTCCTCCTTCCGAGTAGCTGGG - Intergenic
968406178 4:341174-341196 TCTCCTGCCTCCGAGTAGCTGGG + Intronic
968639867 4:1708135-1708157 GCTTCAGCCTCCAAGTAGCTGGG - Intronic
969396534 4:6925175-6925197 CCTCCTCCTCCCAAGTAGCTGGG - Intronic
971287795 4:25307251-25307273 GCTTCAGCCTCCAAGTAGCTGGG + Intergenic
971411275 4:26375186-26375208 GATCCTACTCCCCAGTAGCTAGG - Intronic
971606376 4:28663499-28663521 CATCAACCTTCCAAGTAGCTAGG - Intergenic
971777452 4:30985070-30985092 GATTCTCCTGCCCAGTAGCTGGG + Intronic
972505146 4:39714003-39714025 CCTCATCCTTCCAAGTAGCTGGG + Intronic
972529784 4:39951015-39951037 CATCATCCTCCCAAGTAGCTGGG + Intronic
972747897 4:41958124-41958146 CTTCAGCCCTCCAAGTAGCTGGG + Exonic
973328171 4:48885102-48885124 CAGCCTCCCTCTCAGTAGCTGGG + Exonic
973695990 4:53491901-53491923 GATTCTTCTGCCAAGTAGCTGGG + Intronic
973951064 4:56014942-56014964 GCTCAGCCCCCCAAGTAGCTGGG - Intronic
974025576 4:56730479-56730501 CAGCCTCCTCCCAAGTAGCTGGG + Intergenic
975108478 4:70596172-70596194 GATTCTCCTCCCAAGTAGCTGGG - Intronic
975326261 4:73062170-73062192 CCTCCTCCTCCCAAGTAGCTGGG + Intronic
975494021 4:75018232-75018254 GTGTCTCCCTCCATGTAGCTTGG - Intronic
975586412 4:75954555-75954577 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
975603163 4:76125173-76125195 CATCAGCCTTCCAAGTAGCTGGG - Intronic
976053144 4:81031510-81031532 GAGCCTCCCTCCAGGGAGCCCGG - Exonic
976127222 4:81846725-81846747 CAGCCTCCCTCCGAGTAGTTGGG - Intronic
976617054 4:87088708-87088730 CATTCTCCTGCCAAGTAGCTGGG + Intronic
977002995 4:91526708-91526730 GATTCTCCTGCCAAGTAGCTGGG + Intronic
977200263 4:94106901-94106923 CAGCCTCCCACCAAGTAGCTGGG + Intergenic
977620822 4:99135311-99135333 CTTCAGCCCTCCAAGTAGCTGGG - Intronic
977933550 4:102775346-102775368 TCTCATCCTTCCAAGTAGCTGGG - Intergenic
978557041 4:109992056-109992078 GCTCAACCCACCAAGTAGCTTGG - Intronic
978782292 4:112568594-112568616 GCCTCTGCCTCCAAGTAGCTGGG - Intronic
979227195 4:118300124-118300146 CCTCATCCCCCCAAGTAGCTGGG + Intronic
979572419 4:122243631-122243653 CCTCCTCCTCCCAAGTAGCTGGG - Intronic
979840097 4:125428180-125428202 GCTCAACCTTCCAAGTAGCTGGG - Intronic
980108331 4:128609773-128609795 CATCAGCCCCCCAAGTAGCTGGG - Intergenic
980227428 4:130004657-130004679 CAGTCCCCCTCCAAGTAGCTGGG - Intergenic
980385656 4:132086068-132086090 CAACCTACCACCAAGTAGCTGGG + Intergenic
980391098 4:132147777-132147799 AATTCTCCCTCAAACTAGCTAGG + Intergenic
980679670 4:136142000-136142022 GTTTCAGCCTCCAAGTAGCTGGG + Intergenic
981270174 4:142837048-142837070 GATTCTCCTCCCAAGTAGCTGGG - Intronic
981524560 4:145696919-145696941 CCTCATCCTTCCAAGTAGCTGGG - Intronic
981533575 4:145776343-145776365 CCTCCTCCTCCCAAGTAGCTGGG - Intronic
981682933 4:147421065-147421087 TATCAGCCTTCCAAGTAGCTAGG - Intergenic
981830564 4:148995157-148995179 CCTCAGCCCTCCAAGTAGCTAGG - Intergenic
982042160 4:151407921-151407943 GAGCCTCAGTCCAAGCAGCTGGG - Intergenic
982243406 4:153323595-153323617 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
984806310 4:183754988-183755010 CAGCCCCCCGCCAAGTAGCTGGG + Intergenic
986191711 5:5502652-5502674 GACCCTCCCTCCATGTAGGTGGG + Intergenic
986725371 5:10592505-10592527 GCTCAGCCTTCCAAGTAGCTGGG - Intronic
987330284 5:16850908-16850930 TCTCCTGCCTCCAAGTAGCTGGG + Intronic
987588877 5:19896241-19896263 GATTCTCCTGCAAAGTAGCTGGG - Intronic
987614975 5:20261623-20261645 CATTCTCCTCCCAAGTAGCTGGG - Intronic
987904699 5:24060626-24060648 GATTCTCCTCCCGAGTAGCTGGG - Intronic
988096638 5:26621251-26621273 GTTCAGCCTTCCAAGTAGCTGGG - Intergenic
988330804 5:29837401-29837423 ACTCATCCTTCCAAGTAGCTGGG + Intergenic
988588463 5:32528258-32528280 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
989078737 5:37593037-37593059 CCTCATCCATCCAAGTAGCTAGG - Intronic
989796800 5:45484317-45484339 GCCCCAGCCTCCAAGTAGCTGGG - Intronic
990346761 5:54879363-54879385 CCTCATCCCCCCAAGTAGCTGGG - Intergenic
990577565 5:57138027-57138049 GATTCTCCTCCCGAGTAGCTGGG + Intergenic
990800007 5:59590427-59590449 CATCAGCCTTCCAAGTAGCTAGG - Intronic
991240269 5:64451068-64451090 CATCAGCCTTCCAAGTAGCTAGG + Intergenic
991349408 5:65705336-65705358 GCTTCAGCCTCCAAGTAGCTGGG - Intronic
991704349 5:69344053-69344075 GATCAGCCTCCCAAGTAGCTGGG + Intergenic
991907959 5:71530956-71530978 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
992029075 5:72702733-72702755 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
992467286 5:77018995-77019017 GATGATCCTCCCAAGTAGCTGGG + Intergenic
992885419 5:81154354-81154376 GATCAGCCTCCCAAGTAGCTAGG + Intronic
993573181 5:89568284-89568306 GATCAGCCTCCCAAGTAGCTGGG + Intergenic
993740461 5:91531955-91531977 CCTCATCCATCCAAGTAGCTGGG - Intergenic
994631495 5:102294022-102294044 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
996246090 5:121264952-121264974 CCTCGGCCCTCCAAGTAGCTGGG - Intergenic
997513859 5:134471622-134471644 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
998008361 5:138672711-138672733 GCTCAGCCTTCCAAGTAGCTGGG - Intronic
998085457 5:139318556-139318578 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
998439269 5:142142810-142142832 CATTCTCCTCCCAAGTAGCTGGG - Intronic
998686217 5:144529741-144529763 CCTCATCCTTCCAAGTAGCTGGG - Intergenic
998862071 5:146454093-146454115 GATTCTTCTCCCAAGTAGCTGGG - Intronic
998876152 5:146601471-146601493 GCTCATCCACCCAAGTAGCTGGG - Intronic
999236179 5:150097144-150097166 GATCAGCCTTCCAAGTAGCTAGG - Intronic
999479187 5:151929900-151929922 TCTCCTGCCTCCGAGTAGCTGGG + Intergenic
999704991 5:154264195-154264217 CCTCCACCTTCCAAGTAGCTGGG - Intronic
1000079320 5:157830062-157830084 CATCAGCCTTCCAAGTAGCTGGG + Intronic
1000212258 5:159118835-159118857 CATTCTCCCTCCGAGTAGCTGGG + Intergenic
1000609850 5:163361928-163361950 CCTCATCCCTCCAAGTAGCTGGG - Intergenic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1001062070 5:168500070-168500092 GCTTCAGCCTCCAAGTAGCTGGG - Intronic
1001239211 5:170055534-170055556 GAATCACCCTCCAATTAGCTGGG + Intronic
1001467597 5:171982390-171982412 CAGCCTTCCACCAAGTAGCTGGG + Intronic
1001497101 5:172196490-172196512 GATTCTCCTCCCTAGTAGCTGGG + Intronic
1001819433 5:174698515-174698537 GATCCTCCCTTGAAGCAGGTGGG + Intergenic
1002370655 5:178751217-178751239 GATTCTCCTGCCAGGTAGCTGGG - Intergenic
1002498104 5:179629409-179629431 CAGCCTCCCAACAAGTAGCTGGG + Intronic
1002511088 5:179718340-179718362 GCCTCACCCTCCAAGTAGCTGGG + Intronic
1002511802 5:179725139-179725161 CAGCACCCCTCCAAGTAGCTGGG + Intronic
1002588327 5:180267747-180267769 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1003000572 6:2328432-2328454 GCTGCACCCTCCAAGTAGCTGGG + Intergenic
1003048244 6:2755652-2755674 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1003363872 6:5454458-5454480 CAGCCTCCCCCCGAGTAGCTGGG + Intronic
1004010225 6:11678095-11678117 CCTCAGCCCTCCAAGTAGCTTGG - Intergenic
1004214138 6:13685810-13685832 CAGCCTCCCTCCCATTAGCTGGG - Intronic
1004555973 6:16698350-16698372 CATTCTCACTCCCAGTAGCTGGG + Intronic
1004612877 6:17262454-17262476 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1004743573 6:18487829-18487851 CATCCTGCCTCCAAGTAAATTGG - Intergenic
1004929062 6:20444089-20444111 GCTCAGCCTTCCAAGTAGCTGGG - Intronic
1004948213 6:20638715-20638737 GATTCTCCTCCCAAGTATCTGGG + Intronic
1005009441 6:21322197-21322219 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1005159534 6:22843136-22843158 GATCCCACCTCCAAGTACTTTGG + Intergenic
1005447895 6:25943741-25943763 GACTCAGCCTCCAAGTAGCTGGG - Intergenic
1005455085 6:26011956-26011978 TCTCCTCCTCCCAAGTAGCTGGG - Intergenic
1006589620 6:35144664-35144686 CCTCATTCCTCCAAGTAGCTGGG + Intronic
1006591203 6:35159067-35159089 AATTCTCCTCCCAAGTAGCTAGG - Intergenic
1006669484 6:35720738-35720760 GATCGTGGCTCCAAGGAGCTGGG - Intronic
1006862727 6:37183816-37183838 GTTCAGCCTTCCAAGTAGCTGGG + Intergenic
1007329588 6:41094821-41094843 TCTCAACCCTCCAAGTAGCTGGG - Intronic
1007394529 6:41570006-41570028 TGTCATCCCTCTAAGTAGCTTGG - Intronic
1007494602 6:42251109-42251131 GCTCATCCACCCAAGTAGCTGGG + Intronic
1008288968 6:49688985-49689007 CAGCCTCCTCCCAAGTAGCTGGG + Intergenic
1008415914 6:51239745-51239767 GATCCTGCATCCAAGAAGGTAGG - Intergenic
1009022276 6:57958171-57958193 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1010225107 6:73481650-73481672 CCTCATCCCCCCAAGTAGCTGGG - Intronic
1010227438 6:73504245-73504267 TCTCAGCCCTCCAAGTAGCTGGG + Intronic
1010240074 6:73607381-73607403 CCTCATCCTTCCAAGTAGCTGGG + Intronic
1010830052 6:80516253-80516275 GATCCTCCCTCCAAGAAGCCAGG + Intergenic
1010967860 6:82233209-82233231 CTTCAGCCCTCCAAGTAGCTGGG - Intronic
1011570883 6:88733243-88733265 CAGCCTTCTTCCAAGTAGCTGGG - Intronic
1012002235 6:93667415-93667437 GACCCTCCCTCAATGTAGGTGGG + Intergenic
1012466561 6:99522351-99522373 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1012564470 6:100630004-100630026 TCTCCTGTCTCCAAGTAGCTGGG + Intronic
1012614040 6:101252960-101252982 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1012885557 6:104842191-104842213 CATCATCCTTCCAAGTAGCTGGG - Intronic
1013320329 6:108981780-108981802 GCTCAGCCTTCCAAGTAGCTGGG + Intergenic
1013572206 6:111440183-111440205 CGGCCTCCCTCCTAGTAGCTGGG + Intronic
1014446458 6:121534035-121534057 GCTCAGCCTTCCAAGTAGCTGGG + Intergenic
1014462214 6:121709503-121709525 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1015028628 6:128567993-128568015 CAGCCTCCCTTCAAGTAGCTGGG - Intergenic
1015062820 6:128987978-128988000 GATTCTCCTCCCAAATAGCTGGG + Intronic
1015534462 6:134253542-134253564 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1015947715 6:138520403-138520425 CCTCCACCTTCCAAGTAGCTGGG + Intronic
1015982368 6:138852164-138852186 GATCCTCCCAAGGAGTAGCTGGG - Intronic
1016029059 6:139319056-139319078 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1016381865 6:143492286-143492308 CCTCATCCCTACAAGTAGCTGGG - Intergenic
1016629711 6:146214098-146214120 GATCCACCCTCAAAGTGGCCAGG - Intronic
1016670467 6:146699515-146699537 GATCCACCCTCAATGTAGATGGG - Intronic
1016775379 6:147899063-147899085 CATTCTCCTCCCAAGTAGCTGGG - Intergenic
1016822885 6:148362730-148362752 CTTCATCCTTCCAAGTAGCTGGG - Intronic
1016826970 6:148397368-148397390 GCTTCAGCCTCCAAGTAGCTGGG - Intronic
1016976441 6:149813682-149813704 CATCAGCCCCCCAAGTAGCTAGG - Intergenic
1017176437 6:151508897-151508919 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1017524862 6:155233716-155233738 GATCCTCCCACCAAACTGCTGGG - Intronic
1018369541 6:163155299-163155321 GCTCGTCCCTCCATGAAGCTGGG + Intronic
1018451720 6:163915122-163915144 CATCAGCCCTTCAAGTAGCTGGG + Intergenic
1019120938 6:169802752-169802774 TCTCCTGCCTCCGAGTAGCTGGG - Intergenic
1019974372 7:4568941-4568963 CCTCAGCCCTCCAAGTAGCTAGG + Intergenic
1020115586 7:5474425-5474447 CAGCCTCCCCCTAAGTAGCTGGG + Intronic
1020270596 7:6592722-6592744 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1021143863 7:17061158-17061180 AATTCTCCTCCCAAGTAGCTGGG + Intergenic
1021704697 7:23355335-23355357 CTTCCTCCTCCCAAGTAGCTGGG + Intronic
1021711078 7:23415726-23415748 GCTCTTCCCTCCAAGTCTCTAGG + Intronic
1022019018 7:26380548-26380570 CCTCATCCCTCCAAGTAGCTGGG - Intergenic
1022134004 7:27430650-27430672 AATCCTCCCACCGAGTAGCTGGG + Intergenic
1022515079 7:30970156-30970178 GCTTCTCCCTCCAAGTAACTTGG - Intronic
1023442523 7:40198876-40198898 CCTCATCCTTCCAAGTAGCTGGG - Intronic
1023445326 7:40225549-40225571 GCCTCACCCTCCAAGTAGCTGGG + Intronic
1024025302 7:45405004-45405026 GATCCTCCTTCCAAAGTGCTGGG + Intergenic
1024377139 7:48652782-48652804 CATGCTCCCTCCAAGACGCTAGG + Intergenic
1024547560 7:50535260-50535282 AATTCTCCTCCCAAGTAGCTGGG + Intronic
1024570861 7:50722007-50722029 GATCCTCCCTACCAGCAGCCTGG - Intronic
1025115433 7:56254204-56254226 CCTCCACCTTCCAAGTAGCTAGG - Intergenic
1025910553 7:65825229-65825251 CCTCATCCCTCCCAGTAGCTGGG + Intergenic
1025923933 7:65941219-65941241 GATCAGCCTTCCAAGTAGCTGGG + Intronic
1026127419 7:67591578-67591600 GATTCTCCTCCCAAGTAGCTGGG - Intergenic
1026478418 7:70757895-70757917 CACCCTCCGCCCAAGTAGCTGGG + Intronic
1026493254 7:70881274-70881296 CATCATCCTCCCAAGTAGCTGGG - Intergenic
1026686553 7:72515147-72515169 GATCCTCCTGCCGAGTAGCTGGG + Intergenic
1026737092 7:72955785-72955807 ACTTCACCCTCCAAGTAGCTGGG + Intergenic
1026773537 7:73217076-73217098 CAGCCTCCTCCCAAGTAGCTGGG + Intergenic
1027008739 7:74723239-74723261 CAGCCTTCCTCCGAGTAGCTGGG + Intronic
1027014396 7:74770470-74770492 CAGCCTCCTCCCAAGTAGCTGGG + Intergenic
1027073637 7:75175561-75175583 CAGCCTCCTCCCAAGTAGCTGGG - Intergenic
1027106640 7:75409283-75409305 ACTTCACCCTCCAAGTAGCTGGG - Intronic
1027197223 7:76039051-76039073 GATTCTCCTACCAAGTAGCTGGG + Intronic
1027508467 7:79048870-79048892 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1028171886 7:87607665-87607687 CATCCTCCTCTCAAGTAGCTGGG + Intronic
1028194537 7:87890414-87890436 TATCAGCCTTCCAAGTAGCTGGG - Intronic
1029085314 7:98006800-98006822 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1029247456 7:99212783-99212805 GATCCTCCCACCGAGTATCTGGG - Intergenic
1029383439 7:100228127-100228149 GATCAGCCCACCGAGTAGCTGGG + Intronic
1029461394 7:100695675-100695697 GATCCTCCTTCCAAGGTGCCGGG + Intergenic
1029860634 7:103567910-103567932 CCTCTGCCCTCCAAGTAGCTGGG + Intronic
1029961620 7:104693733-104693755 CACCCTCCTCCCAAGTAGCTGGG + Intronic
1030068257 7:105677029-105677051 GATCCTCCCTCCACGGGGCCTGG - Intronic
1031038382 7:116813331-116813353 CCTCCGCCCTCCAAGTAGCTGGG + Intronic
1031609017 7:123803171-123803193 TCTCAGCCCTCCAAGTAGCTAGG - Intergenic
1031609231 7:123805877-123805899 GCTTCAGCCTCCAAGTAGCTGGG - Intergenic
1032042519 7:128574997-128575019 CTTCCCACCTCCAAGTAGCTGGG - Intergenic
1032199521 7:129809532-129809554 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1032505601 7:132432134-132432156 CCTCCTCACTCCAAGAAGCTGGG + Intronic
1032808128 7:135378867-135378889 CCTCAACCCTCCAAGTAGCTGGG - Intronic
1033108324 7:138551429-138551451 CATCAGCCTTCCAAGTAGCTGGG - Intronic
1033240115 7:139671664-139671686 CCTCATCCTTCCAAGTAGCTGGG + Intronic
1033713280 7:143971934-143971956 GCTCAGCCTTCCAAGTAGCTGGG + Intergenic
1034011054 7:147530293-147530315 CATCAGCCTTCCAAGTAGCTGGG + Intronic
1034177003 7:149107984-149108006 GCCCCTACCTCCAAGTAGCTGGG + Intronic
1034190914 7:149213008-149213030 GACCCTCCCTACAAGTTTCTTGG - Intronic
1034514138 7:151560805-151560827 AATCCTCCCACCAAGTAACTGGG - Intronic
1034960394 7:155361040-155361062 GACCCTCCCACCGAGGAGCTGGG + Exonic
1035007613 7:155679054-155679076 CTTCAGCCCTCCAAGTAGCTGGG - Intronic
1035137152 7:156715065-156715087 CCTCATCCTTCCAAGTAGCTGGG + Intronic
1035922252 8:3690241-3690263 CAGCCTCCTCCCAAGTAGCTGGG - Intronic
1036410959 8:8500529-8500551 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1036671829 8:10794540-10794562 GATTCTCCTGCCAAGTAGCTGGG + Intronic
1037424780 8:18743831-18743853 CCTCCCCCCTCAAAGTAGCTGGG - Intronic
1037635901 8:20700878-20700900 GATCCATCCTCCATGTGGCTGGG + Intergenic
1037789727 8:21927131-21927153 TAGCCTCCCCCCCAGTAGCTGGG - Intronic
1037982627 8:23265292-23265314 GCTCATCCTCCCAAGTAGCTGGG - Intergenic
1038110154 8:24487527-24487549 AATTCTCCTCCCAAGTAGCTGGG - Intronic
1038337939 8:26660597-26660619 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1038967962 8:32596483-32596505 GACTCAGCCTCCAAGTAGCTGGG - Intronic
1039040950 8:33408208-33408230 GCTTCAGCCTCCAAGTAGCTGGG - Intronic
1039274575 8:35920984-35921006 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1039470632 8:37811590-37811612 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1039486596 8:37914999-37915021 GATCCTCCTCCCGAGTACCTGGG - Intergenic
1039673828 8:39636132-39636154 CCTCATCCTTCCAAGTAGCTGGG + Intronic
1039818078 8:41112371-41112393 AATTCTCCTCCCAAGTAGCTGGG + Intergenic
1039841121 8:41293876-41293898 GCACATCCCACCAAGTAGCTGGG + Intronic
1039964763 8:42275954-42275976 GCTTCAGCCTCCAAGTAGCTGGG + Intronic
1039975873 8:42364342-42364364 AATCCTCCCACCTAGTAGCTGGG + Intronic
1041731346 8:61066380-61066402 CCTCAGCCCTCCAAGTAGCTAGG - Intronic
1041776064 8:61523974-61523996 AATTCTCCTCCCAAGTAGCTAGG - Intronic
1042511519 8:69617288-69617310 CAGCCTCCCTCCAAGTAGCTGGG + Intronic
1042563477 8:70091090-70091112 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1042878574 8:73462509-73462531 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1042928783 8:73993389-73993411 GCTCAGCCTTCCAAGTAGCTGGG + Intronic
1043537999 8:81227288-81227310 GATCAGCCTTCCAAGTAGCTGGG + Intergenic
1043974283 8:86567448-86567470 TCTCATCCTTCCAAGTAGCTGGG + Intronic
1044061124 8:87637114-87637136 ATTACTTCCTCCAAGTAGCTGGG + Intergenic
1044468877 8:92541623-92541645 GATCCTCCCTCCATGTGACTGGG + Intergenic
1044568460 8:93691616-93691638 CCTCAGCCCTCCAAGTAGCTAGG + Intergenic
1045934447 8:107662755-107662777 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1046008378 8:108514286-108514308 AGGCCTCCCTCCAAGTAGCTGGG - Intergenic
1046179533 8:110625974-110625996 GATTCTCCTCCCAAGTAGCTGGG + Intergenic
1046361635 8:113166387-113166409 GCTTATCCTTCCAAGTAGCTGGG - Intronic
1046414953 8:113901192-113901214 CAGCCTCCCCCCGAGTAGCTGGG + Intergenic
1046623383 8:116551736-116551758 AATTCTCCTTCCCAGTAGCTGGG + Intergenic
1047570738 8:126095797-126095819 CAGCCTCCCCCCTAGTAGCTGGG - Intergenic
1048284279 8:133129610-133129632 CCTCACCCCTCCAAGTAGCTGGG + Intronic
1048349729 8:133606530-133606552 TATCCTCCCTCCAAGCCTCTTGG + Intergenic
1048462907 8:134637560-134637582 CAGCCTGCCTCCAAGCAGCTTGG - Exonic
1048973111 8:139656207-139656229 GGCCCTCCCTGCAAGCAGCTTGG + Intronic
1049056511 8:140241281-140241303 GATTCTCCTCCCTAGTAGCTGGG - Intronic
1049193393 8:141301617-141301639 CCTCCACCCTCCAGGTAGCTGGG - Intronic
1049899760 9:147908-147930 GCTTCACCCTCCGAGTAGCTGGG - Intronic
1049939594 9:532652-532674 GATGCTCACGCCAAGTAGCTTGG - Intronic
1050073289 9:1838878-1838900 GATTCGCCTCCCAAGTAGCTGGG + Intergenic
1050355574 9:4780080-4780102 TCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1050457426 9:5847352-5847374 CCTCAGCCCTCCAAGTAGCTAGG + Intergenic
1050882711 9:10722838-10722860 AATCCTTCCTCCAAGTAGGATGG + Intergenic
1050934460 9:11377482-11377504 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1052139095 9:24955523-24955545 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1052179550 9:25507090-25507112 GCTCAGCCTTCCAAGTAGCTGGG + Intergenic
1052186055 9:25595642-25595664 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1052654848 9:31344723-31344745 GATCAGCCTCCCAAGTAGCTGGG + Intergenic
1052912318 9:33894547-33894569 CATCCACCTCCCAAGTAGCTGGG + Intronic
1052922497 9:33982991-33983013 GCCCCGGCCTCCAAGTAGCTGGG + Intronic
1053045691 9:34915146-34915168 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1053096817 9:35335802-35335824 GCTTCAGCCTCCAAGTAGCTGGG + Intronic
1053388539 9:37715875-37715897 GTGACTCCCACCAAGTAGCTCGG + Intronic
1053559896 9:39181075-39181097 CCTCCCCCTTCCAAGTAGCTGGG - Intronic
1053824005 9:42001296-42001318 CCTCCCCCTTCCAAGTAGCTGGG - Intronic
1053932962 9:43126058-43126080 GCTCCTCCCTCCCTGTTGCTTGG - Intergenic
1054137220 9:61437880-61437902 CCTCCCCCTTCCAAGTAGCTGGG + Intergenic
1054149529 9:61590002-61590024 CCTCCTCCTCCCAAGTAGCTGGG - Intergenic
1054348088 9:63988037-63988059 GCTTCACCCTCCGAGTAGCTGGG - Intergenic
1054445817 9:65314382-65314404 GCTTCACCCTCCGAGTAGCTGGG - Intergenic
1054469289 9:65521105-65521127 CCTCCTCCTCCCAAGTAGCTGGG - Intergenic
1054484453 9:65707123-65707145 GCTTCACCCTCCGAGTAGCTGGG + Intronic
1054606568 9:67186067-67186089 CCTCCCCCTTCCAAGTAGCTGGG + Intergenic
1054685530 9:68273102-68273124 GCTTCACCCTCCGAGTAGCTGGG + Intronic
1054912093 9:70464414-70464436 CATCAGCCCCCCAAGTAGCTGGG + Intergenic
1055109144 9:72542343-72542365 GCCTCACCCTCCAAGTAGCTGGG - Intronic
1055302326 9:74894746-74894768 GCTCAGCCTTCCAAGTAGCTGGG - Intergenic
1055406326 9:75977724-75977746 CCTCATCCCCCCAAGTAGCTGGG + Intronic
1055538166 9:77270756-77270778 GATCCTTCCCCCACTTAGCTAGG - Intronic
1055914421 9:81386220-81386242 GATCCTCCCTTAACCTAGCTAGG - Intergenic
1056920212 9:90780842-90780864 AATTCTCCTCCCAAGTAGCTGGG - Intergenic
1056932989 9:90893967-90893989 GATGCTGCCTCCAGGAAGCTGGG - Intronic
1057170962 9:92962823-92962845 CCTCATCCTTCCAAGTAGCTGGG - Intronic
1057502723 9:95608493-95608515 GATCTTGAGTCCAAGTAGCTGGG + Intergenic
1058089876 9:100793383-100793405 CATCAACCTTCCAAGTAGCTGGG + Intergenic
1058568162 9:106309447-106309469 CCTCCGCCTTCCAAGTAGCTGGG - Intergenic
1058976859 9:110132719-110132741 GATTCTCATGCCAAGTAGCTGGG + Intronic
1059050138 9:110915419-110915441 CATCAGCCTTCCAAGTAGCTGGG - Intronic
1059112671 9:111571591-111571613 CCTCCGCCCTGCAAGTAGCTGGG + Intronic
1059149123 9:111931911-111931933 CCTCATCCCACCAAGTAGCTGGG - Intronic
1060252547 9:121997767-121997789 GAGACTCCCTCCAAGTAGGTTGG - Intronic
1060507799 9:124211317-124211339 GATTCTCCTGCCAAGTAGCTGGG + Intergenic
1060635568 9:125197290-125197312 CATCATCCTCCCAAGTAGCTGGG - Intergenic
1060842117 9:126801946-126801968 TTTCATCCTTCCAAGTAGCTGGG + Intergenic
1061153756 9:128844747-128844769 GCTTCAGCCTCCAAGTAGCTGGG - Intronic
1061558741 9:131388954-131388976 CCTCGTCCTTCCAAGTAGCTGGG + Intergenic
1061591405 9:131599999-131600021 GCCCCAGCCTCCAAGTAGCTGGG - Intronic
1062415989 9:136450399-136450421 GATCCTCCTGCCTCGTAGCTGGG - Intronic
1062535521 9:137019536-137019558 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1186793649 X:13023575-13023597 GCCTCACCCTCCAAGTAGCTGGG + Intergenic
1186988104 X:15038200-15038222 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1187481171 X:19657263-19657285 CCTCAGCCCTCCAAGTAGCTGGG - Intronic
1187504194 X:19865482-19865504 GATTCTCCTTCCAACTAGCTGGG + Intronic
1187545571 X:20248596-20248618 CAGCCTCCTTCCAAGTAGCTGGG + Intronic
1187722024 X:22161017-22161039 CAGCCTCCCACCGAGTAGCTGGG - Intronic
1188474959 X:30581823-30581845 GATTCTCCTCCCGAGTAGCTGGG - Intergenic
1188732378 X:33666107-33666129 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1189389206 X:40561944-40561966 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1189801519 X:44695882-44695904 CCTCAGCCCTCCAAGTAGCTGGG - Intergenic
1190067644 X:47252751-47252773 GTTCAGCCCCCCAAGTAGCTAGG + Intergenic
1190096768 X:47487624-47487646 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1190218796 X:48497494-48497516 GATCAGCCTCCCAAGTAGCTGGG - Intergenic
1190782952 X:53616026-53616048 CCTCAGCCCTCCAAGTAGCTGGG + Intronic
1190791302 X:53703021-53703043 CAGCCTCTCCCCAAGTAGCTGGG - Intergenic
1192114329 X:68396312-68396334 CATCAGCCTTCCAAGTAGCTGGG - Intronic
1192311785 X:70022450-70022472 GCTCAGCCTTCCAAGTAGCTGGG + Intronic
1192364690 X:70461674-70461696 GATTCTCCTCCCAAGTAGCTGGG + Intronic
1192447558 X:71222352-71222374 GATTCTCCCACCCAGCAGCTGGG + Intronic
1192741933 X:73901874-73901896 GCTTCAGCCTCCAAGTAGCTAGG + Intergenic
1194743465 X:97603371-97603393 CATCAGCCTTCCAAGTAGCTGGG + Exonic
1195041231 X:101016580-101016602 GATTCTCATGCCAAGTAGCTGGG + Intronic
1195758334 X:108220980-108221002 CCTCCACCTTCCAAGTAGCTGGG - Intronic
1195793785 X:108621271-108621293 CAGCCTCCTCCCAAGTAGCTGGG + Intronic
1196787366 X:119432671-119432693 GCCCCAGCCTCCAAGTAGCTGGG - Intronic
1197924586 X:131633312-131633334 CCTCAGCCCTCCAAGTAGCTGGG + Intergenic
1197959015 X:131983590-131983612 CCTCCACCTTCCAAGTAGCTGGG - Intergenic
1198073859 X:133176234-133176256 TGTCCTCTCTGCAAGTAGCTTGG + Intergenic
1198218143 X:134575393-134575415 AATCCTCCTGCCAAGTAGCTGGG - Intronic
1198470195 X:136939299-136939321 CCTCATCCCCCCAAGTAGCTGGG + Intergenic
1199100172 X:143790194-143790216 GATCCTCCCTCCATGTGAGTGGG - Intergenic
1200305313 X:155019676-155019698 TATCAGCCCCCCAAGTAGCTGGG - Intronic
1200306654 X:155032390-155032412 GATTCTCCTCCCGAGTAGCTAGG + Intronic
1200986716 Y:9308725-9308747 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1201715493 Y:17040392-17040414 ATTCATCCTTCCAAGTAGCTGGG + Intergenic
1202118971 Y:21505080-21505102 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1202121423 Y:21528620-21528642 CATCAGCCTTCCAAGTAGCTGGG + Intronic
1202123867 Y:21552194-21552216 CATCAGCCTTCCAAGTAGCTGGG + Intergenic
1202155141 Y:21877186-21877208 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1202157580 Y:21900762-21900784 CATCAGCCTTCCAAGTAGCTGGG - Intronic
1202160030 Y:21924299-21924321 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1202184028 Y:22165686-22165708 CATCAGCCTTCCAAGTAGCTGGG - Intergenic
1202207331 Y:22420715-22420737 CATCAGCCTTCCAAGTAGCTGGG + Intergenic