ID: 931564405

View in Genome Browser
Species Human (GRCh38)
Location 2:63600039-63600061
Sequence GTAGGTCATCACTGCTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931564402_931564405 -7 Left 931564402 2:63600023-63600045 CCATCCCTTCTTGTCTGTAGGTC 0: 1
1: 0
2: 0
3: 28
4: 237
Right 931564405 2:63600039-63600061 GTAGGTCATCACTGCTAGATAGG 0: 1
1: 0
2: 1
3: 8
4: 83
931564400_931564405 9 Left 931564400 2:63600007-63600029 CCTAATGCTTTTCTGGCCATCCC 0: 1
1: 0
2: 1
3: 20
4: 253
Right 931564405 2:63600039-63600061 GTAGGTCATCACTGCTAGATAGG 0: 1
1: 0
2: 1
3: 8
4: 83
931564397_931564405 16 Left 931564397 2:63600000-63600022 CCTTTGCCCTAATGCTTTTCTGG 0: 1
1: 0
2: 0
3: 20
4: 218
Right 931564405 2:63600039-63600061 GTAGGTCATCACTGCTAGATAGG 0: 1
1: 0
2: 1
3: 8
4: 83
931564399_931564405 10 Left 931564399 2:63600006-63600028 CCCTAATGCTTTTCTGGCCATCC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 931564405 2:63600039-63600061 GTAGGTCATCACTGCTAGATAGG 0: 1
1: 0
2: 1
3: 8
4: 83
931564396_931564405 23 Left 931564396 2:63599993-63600015 CCTCTTTCCTTTGCCCTAATGCT 0: 1
1: 0
2: 2
3: 15
4: 336
Right 931564405 2:63600039-63600061 GTAGGTCATCACTGCTAGATAGG 0: 1
1: 0
2: 1
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931564405 Original CRISPR GTAGGTCATCACTGCTAGAT AGG Intronic
905380156 1:37556214-37556236 GTAGGTCGTCACCGCAAGAAAGG - Intergenic
911579675 1:99620341-99620363 GGAGGTCATTACTGCTACAGTGG + Intergenic
912352771 1:109030031-109030053 GTAGGTCGTCACTGCCAGAAAGG - Intronic
912729033 1:112085287-112085309 GTTGGTCATCACCGCTAGTCTGG - Intergenic
1064323686 10:14329508-14329530 GTTGGCCATCAATGGTAGATAGG + Intronic
1066476671 10:35753589-35753611 ATGGGTAATCACAGCTAGATAGG + Intergenic
1067539824 10:47143443-47143465 GTAGGTCTTCCCTGCTGGCTTGG - Intergenic
1067971167 10:50972611-50972633 GTAGGTTATCTCTGCAAAATGGG + Intergenic
1071160523 10:82740404-82740426 ATAGTTCATCACTGCAAGAGTGG + Intronic
1075544807 10:123347097-123347119 GTAAGTCATCACAGCCAGACTGG - Intergenic
1077928186 11:6703577-6703599 GCAGGACACCACTGCTAAATTGG - Intergenic
1077945428 11:6892141-6892163 ATAGGACATCACTGCAAGAAGGG + Exonic
1080193715 11:29582490-29582512 GGTGCTCATCACTGGTAGATTGG + Intergenic
1089236850 11:117036064-117036086 GTAGGTCATCACCGCCGGAAAGG + Intronic
1095932559 12:47642621-47642643 GTATGTTCTCACTGCTATATGGG + Intergenic
1098900095 12:76103361-76103383 CGAGGTCATCACTGCTAGAACGG + Intergenic
1100229195 12:92589937-92589959 GAAGCTCATCATTGCAAGATGGG - Intergenic
1101104266 12:101424408-101424430 GTAGGTCATCACTGCCAGAAAGG - Intergenic
1101248139 12:102904313-102904335 CTAGGTTATCACTGATAGTTTGG + Intronic
1105571316 13:21605363-21605385 GTAGATGATCACTGCTATTTGGG + Intergenic
1114310725 14:21464460-21464482 GATGCTCATCACTGCTGGATGGG - Intronic
1114856555 14:26453136-26453158 GCAGTTCATCACTGCTAAAATGG - Intronic
1116371348 14:44137192-44137214 GTTGGTTATCAGTGCTAGAAAGG + Intergenic
1117120102 14:52558352-52558374 GCAGGTCCTCAGAGCTAGATAGG + Intronic
1118560361 14:67073323-67073345 GTAGGATATCACTGATAAATGGG - Intronic
1122102769 14:99426681-99426703 GTCAGTGATCACTACTAGATGGG - Intronic
1122148684 14:99710037-99710059 GTAAGTCATCACTACTAGACTGG + Intronic
1123904834 15:24911136-24911158 GTAGGTCGTCAGTGCTGGAAAGG + Intronic
1124017929 15:25893619-25893641 GAATGTGATCAATGCTAGATTGG + Intergenic
1126059861 15:44770097-44770119 GTATGTCCTCACTGATATATGGG - Intergenic
1140401870 16:74678350-74678372 GTAGCCCATCCCTGCTAAATGGG + Intronic
1141769023 16:86077679-86077701 GAAGGTCCTCTCTGGTAGATGGG + Intergenic
1143841912 17:9739157-9739179 TTACATCACCACTGCTAGATGGG - Intergenic
1146893721 17:36526037-36526059 GTAAGTGATCACTGCTGGCTGGG - Intronic
1149976681 17:61272822-61272844 GAAGGTCAACACATCTAGATTGG - Intronic
1151255360 17:72872339-72872361 GAAGGTCATCAGGGCCAGATGGG + Intronic
1151508352 17:74543619-74543641 TTAGCTCCTCACTCCTAGATAGG + Intronic
1156375104 18:36507195-36507217 GTGGGTGATCAGTGCTAGTTTGG - Intronic
1159701211 18:71630527-71630549 GTTTGTCATCAGTGCTTGATGGG - Intergenic
1163382574 19:16978586-16978608 TTTGGTCATCACTGCTGGAGGGG + Intronic
1164250865 19:23473779-23473801 GTCTGTCATCACCCCTAGATGGG + Intergenic
1164817233 19:31214027-31214049 CCAGGCCATCACTGCTAGAAAGG + Intergenic
925118777 2:1401751-1401773 GGAGGTCATCACTGAGATATTGG - Intronic
931564405 2:63600039-63600061 GTAGGTCATCACTGCTAGATAGG + Intronic
932040436 2:68293739-68293761 GTAGGTCATTAGTACCAGATGGG + Exonic
934872985 2:97885156-97885178 GGAATTCATCACTGCTAGACTGG - Intronic
938408675 2:131046459-131046481 GTAGGGCCTCACTGCTGGAGCGG + Exonic
938870911 2:135475290-135475312 TTATGTCTTCACTGCTAGAGAGG + Intronic
944936473 2:204574317-204574339 GTATGAGATCACTGCTAGTTGGG - Intronic
945557652 2:211299200-211299222 GTAGGTCATCACCGCCAGAAAGG + Intergenic
1172491178 20:35339293-35339315 GTAGGTCACTCCTGTTAGATGGG - Intronic
950597424 3:13996955-13996977 GCAGGTCATCACTGAAAGAAAGG - Intronic
956315700 3:67934099-67934121 GTCTCCCATCACTGCTAGATGGG - Intergenic
958663102 3:97097623-97097645 TTATGTCTTCACTGCCAGATTGG + Intronic
958979893 3:100708998-100709020 GTAGGTCTTCCCTGCTTAATTGG + Intergenic
963038101 3:141049835-141049857 GTAGGTCAGCACTGCCACTTAGG + Intergenic
967413584 3:189192861-189192883 GGAGTTCATCACCACTAGATTGG - Intronic
972432897 4:39001027-39001049 GTTGATCATTACTGCTAAATAGG - Intronic
974406902 4:61484397-61484419 TTAGGTCATCACTGCTTTATTGG + Intronic
976477450 4:85501113-85501135 GATGTTCATCACTGATAGATTGG - Intronic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
988399900 5:30749642-30749664 GTAGGTCATTCCTGGAAGATGGG - Intergenic
995551100 5:113282263-113282285 ATATGTCATCACTGCTAGCTGGG + Intronic
996511796 5:124324821-124324843 GTCAGTCATCACTGGAAGATAGG - Intergenic
996923004 5:128790689-128790711 CCACGTCATCACTGCCAGATGGG + Intronic
997372331 5:133369986-133370008 GGAGGGCAGCCCTGCTAGATAGG - Intronic
998022610 5:138783373-138783395 GTAGGTCATTACTGCTTTTTAGG + Intronic
1007985595 6:46204486-46204508 GTAGGTAATTAATGCTAAATGGG - Intergenic
1008415826 6:51239136-51239158 GAAGGTCAAAACTGCTAGTTAGG - Intergenic
1015662780 6:135594594-135594616 GTATGTTCTCACTGCTATATAGG - Intergenic
1020656040 7:10929276-10929298 GCAGGTCATCTCTCCTAGGTTGG - Intergenic
1021489512 7:21203615-21203637 GTAGGTAATCACTGCTGAATGGG - Intergenic
1025747493 7:64256307-64256329 GTATGTCTTCAATGGTAGATTGG - Intronic
1026362540 7:69615975-69615997 TTAGTTCAGCACTGCTAGACTGG + Intronic
1027726140 7:81808435-81808457 TTAGTTCATCAATGCTAGACTGG + Intergenic
1028692569 7:93670090-93670112 GTAGGTCGTCACTGCCAGAAAGG + Intronic
1028908711 7:96183643-96183665 GTATGTCATCACTGATGGAAAGG - Intronic
1031846271 7:126808972-126808994 GTAGGTCATAAGTGCAAAATGGG + Intronic
1034825991 7:154263159-154263181 ATAGGCAATCACTGCTAGAAAGG - Intronic
1035121349 7:156570542-156570564 GTATGTTTTCACTGATAGATGGG + Intergenic
1036099075 8:5757545-5757567 GTAGGTTACCACTGCTGGCTGGG + Intergenic
1039066409 8:33612334-33612356 GTAGGTCATCACTCCTTCCTGGG + Intergenic
1041544467 8:59026244-59026266 GTAGGTCATCACAGTGACATGGG - Intronic
1042674669 8:71306608-71306630 GGATGTGATCACTGCTATATCGG + Intronic
1050112599 9:2232304-2232326 GTAGGTCACAATGGCTAGATTGG + Intergenic
1056191064 9:84184539-84184561 ATAGGTCAGCGCTGCCAGATAGG + Intergenic
1186595777 X:10980084-10980106 GTATGTGATCACTGATGGATGGG - Intergenic
1189962670 X:46339383-46339405 GTATGTTCTCACTGATAGATGGG + Intergenic
1191096639 X:56680032-56680054 GTAGGCCATCACTGTTTCATTGG + Intergenic
1193951639 X:87808227-87808249 GTGGGTCGCCACTGCTAGCTCGG + Intergenic
1195788774 X:108558435-108558457 ATGGGTCCTCACTGGTAGATAGG + Intronic
1196474085 X:116062206-116062228 GTATGTAATTACAGCTAGATGGG - Intergenic
1199821232 X:151449149-151449171 GTATGTTATCACTGATACATGGG - Intergenic