ID: 931564537

View in Genome Browser
Species Human (GRCh38)
Location 2:63601673-63601695
Sequence TAGAAGGAGCAAGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2850
Summary {0: 1, 1: 0, 2: 26, 3: 397, 4: 2426}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931564530_931564537 15 Left 931564530 2:63601635-63601657 CCTTTGCTGTCCAGACAGAACTG 0: 1
1: 0
2: 4
3: 13
4: 246
Right 931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG 0: 1
1: 0
2: 26
3: 397
4: 2426
931564529_931564537 20 Left 931564529 2:63601630-63601652 CCTGGCCTTTGCTGTCCAGACAG 0: 1
1: 0
2: 1
3: 18
4: 221
Right 931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG 0: 1
1: 0
2: 26
3: 397
4: 2426
931564532_931564537 5 Left 931564532 2:63601645-63601667 CCAGACAGAACTGGATTAGCTCA 0: 1
1: 0
2: 0
3: 3
4: 102
Right 931564537 2:63601673-63601695 TAGAAGGAGCAAGAGGAGGAGGG 0: 1
1: 0
2: 26
3: 397
4: 2426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931564537 Original CRISPR TAGAAGGAGCAAGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr