ID: 931564573

View in Genome Browser
Species Human (GRCh38)
Location 2:63601999-63602021
Sequence AGGCTAAGCAGATCAATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931564568_931564573 -4 Left 931564568 2:63601980-63602002 CCACTCTACCCTATCCCACAGGC 0: 1
1: 0
2: 0
3: 28
4: 251
Right 931564573 2:63601999-63602021 AGGCTAAGCAGATCAATAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931564573 Original CRISPR AGGCTAAGCAGATCAATAGC TGG Intronic
905795321 1:40812852-40812874 AGACTAAGTAAATGAATAGCAGG - Intronic
908848664 1:68351023-68351045 AGACTAAGCAGACCAGAAGCTGG + Intergenic
914009416 1:143763521-143763543 AGGCTAAGCAAATCACTTCCTGG + Intergenic
915952966 1:160202138-160202160 AGGCTAATCAGCTCAAGATCAGG - Intergenic
923991707 1:239444965-239444987 AGGATCAGCAGATCAACAGGTGG + Intronic
1063423794 10:5935695-5935717 AGAATAAGTAGATCAATAGCTGG + Intronic
1067668270 10:48296901-48296923 AGGCTAGGCAAAGGAATAGCAGG - Intergenic
1069387372 10:67896378-67896400 AGGCTAAGCAGGAGAATTGCTGG - Intronic
1071573976 10:86712498-86712520 CGGCTAAGCAGTTCACCAGCTGG + Intronic
1074832245 10:117257025-117257047 AGGCAGAGCATATCAATGGCAGG - Intronic
1076076782 10:127539496-127539518 AGGCTGAGCAGAAGAATCGCTGG + Intergenic
1076346721 10:129784494-129784516 AGGCGAAGCTGATAAACAGCTGG - Intergenic
1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG + Intronic
1080155523 11:29106243-29106265 ATGCAGAGCATATCAATAGCTGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1086401152 11:86461809-86461831 AGGCTGAGCTGATCAAAGGCTGG + Intronic
1086500528 11:87448510-87448532 TAGCTAAGCAGATCAATTCCCGG + Intergenic
1086723310 11:90148434-90148456 AGGAAATGCAGATCAAAAGCAGG + Intronic
1090624189 11:128591641-128591663 AGGCTAAGAAGTTCCAGAGCTGG - Intergenic
1095399724 12:41800602-41800624 AGGCTATTCAAAGCAATAGCTGG + Intergenic
1095552208 12:43456401-43456423 AGGAGAAGCAGAGCAGTAGCTGG - Intronic
1096068355 12:48759116-48759138 ATGCTAACCAGATGCATAGCAGG - Intergenic
1097325241 12:58269165-58269187 ATGGTAAGGAGATCACTAGCAGG + Intergenic
1100170286 12:91968104-91968126 GGGCTAAGCAGAGAAATAGTTGG + Intergenic
1108543840 13:51470931-51470953 TGGCAAATCAGATCAATAGTTGG - Intergenic
1112227843 13:97558061-97558083 AGGCCCAGCACATCAACAGCTGG + Intergenic
1113788098 13:113013429-113013451 AGGCAAAGCAGTCCCATAGCTGG + Intronic
1115458825 14:33636020-33636042 AGGCTAAGCAGGAGAATCGCTGG - Intronic
1117284875 14:54277508-54277530 AGGGTAAGCAGATTAGGAGCAGG - Intergenic
1117886955 14:60374227-60374249 TGGCTAAGCAGATAAAAAACAGG + Intergenic
1118678337 14:68212947-68212969 AGGTTAAGTAGATTCATAGCTGG + Intronic
1121248669 14:92483456-92483478 GGGCTTAGGAGATCAATACCTGG - Intronic
1145095802 17:20024912-20024934 AAGAGAAGCAGTTCAATAGCAGG - Intronic
1145271771 17:21408757-21408779 AGGCTGAGCAGATAAATGGGTGG - Intronic
1145309985 17:21696221-21696243 AGGCTGAGCAGATAAATGGGTGG - Intronic
1147712227 17:42476938-42476960 AGGATAAGAAGCACAATAGCTGG - Intronic
1150835205 17:68557561-68557583 AGGCTAAGAAGTCCAATACCAGG - Intronic
1156043549 18:32852170-32852192 AGGCTATGCTGACCAAAAGCAGG + Intergenic
1157421391 18:47550512-47550534 AGCCTAAACAGAACAAAAGCAGG + Intergenic
1157903215 18:51541081-51541103 AGGCTAAACAGGTCAATCTCAGG - Intergenic
1158979728 18:62748200-62748222 AGGCTATGTTGATAAATAGCAGG + Intronic
1159262862 18:66038331-66038353 AGGGCAATCAGATCAATGGCAGG + Intergenic
1160151381 18:76397084-76397106 AGGCTACGCAGTTCAGAAGCAGG + Intronic
928337017 2:30406873-30406895 AGGTTAAGAGGATCAATAGGGGG + Intergenic
931127990 2:59298777-59298799 AGGCTATGCAGTTAAAGAGCAGG + Intergenic
931564573 2:63601999-63602021 AGGCTAAGCAGATCAATAGCTGG + Intronic
936385782 2:112027775-112027797 GGGCTAAGAAGATCAGGAGCAGG - Intronic
940629385 2:156218380-156218402 AGGCTAAGAAGTTCAATAACAGG - Intergenic
940861267 2:158772803-158772825 AGGCTCAGCATATGAAAAGCTGG - Intergenic
947374371 2:229481075-229481097 CGGCTTTGCAGATCCATAGCTGG - Intronic
947938511 2:234027660-234027682 AGGCTAAGCAGAGAAAGAGAGGG - Intergenic
1170952266 20:20947641-20947663 AGGATAAGCACATCAAAATCAGG - Intergenic
1173785973 20:45792822-45792844 AGGCTATGGAGATCTACAGCCGG + Intronic
1174102950 20:48141031-48141053 AGGCTGAGTAGAACAAGAGCAGG - Intergenic
1178067633 21:28923369-28923391 AGGCTAAGAAGCTAAATAGTGGG + Intergenic
1180743657 22:18072016-18072038 AGGCTGGGCAGATCAATATCTGG + Intergenic
1181385450 22:22542032-22542054 AGGCTAAGAAGTTCCACAGCAGG + Intergenic
1182863755 22:33584159-33584181 AAGCTGAGCAGATAAAAAGCAGG + Intronic
949892539 3:8744060-8744082 AGACTAATCAGATCAACAGGAGG - Intronic
953592384 3:44271305-44271327 AGGCTAATAATATCAAGAGCTGG - Intronic
953687792 3:45091706-45091728 AGGCTCAGCAGACATATAGCTGG - Intronic
960451730 3:117817941-117817963 AGGAGAAGCAGATCAAGATCAGG + Intergenic
962676593 3:137762646-137762668 TGGCTAAGCAAATCAAGCGCAGG + Intergenic
965714884 3:171592273-171592295 ATGAAAAGCATATCAATAGCAGG + Intergenic
969669928 4:8583995-8584017 ATGATAATCAGATAAATAGCTGG - Intronic
972826295 4:42763667-42763689 ATGGTAACCAAATCAATAGCAGG - Intergenic
974226616 4:59053341-59053363 AGGTGAACCAGATCAAGAGCAGG - Intergenic
978072178 4:104487861-104487883 AGACTAAGCAGAAAAATAGAAGG + Intronic
978438328 4:108709349-108709371 TGGCTGAGCAGAGCAATTGCTGG - Intergenic
987484582 5:18508882-18508904 AAGATAAGCAGATAATTAGCTGG + Intergenic
993932518 5:93957252-93957274 AGGCTTAGGTGATCTATAGCAGG + Intronic
996827634 5:127703347-127703369 AGGGACAGCAGAGCAATAGCAGG + Intergenic
997360048 5:133289204-133289226 AAGGTGGGCAGATCAATAGCGGG - Intronic
1001432799 5:171676467-171676489 AGTCTCAGCAAATCACTAGCTGG + Intergenic
1008234954 6:49034041-49034063 AGGCAAAGCAGATTCATTGCAGG + Intergenic
1011586995 6:88936930-88936952 AAGCTGAGCAGACCAATAACAGG - Intronic
1011861534 6:91763764-91763786 AGGCTAAACAAAAGAATAGCAGG - Intergenic
1012808676 6:103929434-103929456 AGACTAAGCATATCATAAGCTGG - Intergenic
1028141885 7:87283070-87283092 AAGATAAGCAAATCCATAGCTGG - Intergenic
1030621110 7:111792277-111792299 AGGCTGAGCAGAAAGATAGCTGG + Intronic
1036094640 8:5710392-5710414 AGGCTAACCAGATGAAAAGGTGG + Intergenic
1039956285 8:42209538-42209560 AGGGTTTGCAGATCATTAGCAGG + Intergenic
1040453604 8:47573828-47573850 AGGCACAGCAGAACTATAGCAGG - Intronic
1040721748 8:50332720-50332742 CGGCTAAGGAGATTAATTGCTGG - Intronic
1041003733 8:53479208-53479230 AGGCTGAGAAGTTCAAGAGCAGG - Intergenic
1041670228 8:60484118-60484140 AGGCTCTCCAGATCAGTAGCAGG + Intergenic
1047127198 8:121975693-121975715 TGCCTAAGCTGATAAATAGCAGG + Intergenic
1047809211 8:128390138-128390160 AGGATAGGCAGATCCTTAGCAGG + Intergenic
1054892247 9:70263418-70263440 ATACTTAGCAGATGAATAGCAGG + Intronic
1056460377 9:86804204-86804226 AGGCTAAAAAGATGAATAGAAGG - Intergenic
1057951942 9:99376160-99376182 AGGCTAAGCAGCACAATACTTGG + Intergenic
1059096195 9:111417365-111417387 AGGCAAAACAGATCAATTACAGG + Intronic
1186432305 X:9515292-9515314 AGGCCAAGCAGATCAGAAGAAGG - Intronic
1199092428 X:143707119-143707141 AGGCTAGGAAGTTCAAGAGCAGG - Intergenic
1200817693 Y:7550465-7550487 AGGCTCAACAGAAGAATAGCTGG + Intergenic