ID: 931568330

View in Genome Browser
Species Human (GRCh38)
Location 2:63640377-63640399
Sequence GCCACTGCCACCTGAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108896
Summary {0: 1, 1: 0, 2: 112, 3: 5835, 4: 102948}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931568330_931568334 2 Left 931568330 2:63640377-63640399 CCAGCTATTCAGGTGGCAGTGGC 0: 1
1: 0
2: 112
3: 5835
4: 102948
Right 931568334 2:63640402-63640424 GAGGATTGCTTAAGCCTGGCAGG 0: 4
1: 181
2: 2791
3: 10178
4: 45174
931568330_931568333 -2 Left 931568330 2:63640377-63640399 CCAGCTATTCAGGTGGCAGTGGC 0: 1
1: 0
2: 112
3: 5835
4: 102948
Right 931568333 2:63640398-63640420 GCAGGAGGATTGCTTAAGCCTGG 0: 39
1: 960
2: 5958
3: 46860
4: 104112
931568330_931568335 8 Left 931568330 2:63640377-63640399 CCAGCTATTCAGGTGGCAGTGGC 0: 1
1: 0
2: 112
3: 5835
4: 102948
Right 931568335 2:63640408-63640430 TGCTTAAGCCTGGCAGGTTGAGG 0: 2
1: 53
2: 1061
3: 4479
4: 22071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931568330 Original CRISPR GCCACTGCCACCTGAATAGC TGG (reversed) Intronic
Too many off-targets to display for this crispr