ID: 931570263

View in Genome Browser
Species Human (GRCh38)
Location 2:63661477-63661499
Sequence GTACAATGCATGGCAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931570260_931570263 14 Left 931570260 2:63661440-63661462 CCACATCTATTTTTCATGACAAT 0: 1
1: 0
2: 1
3: 52
4: 405
Right 931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG 0: 1
1: 0
2: 1
3: 24
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931570263 Original CRISPR GTACAATGCATGGCAAAAAG TGG Intronic
900838484 1:5026372-5026394 ATAGAGTGGATGGCAAAAAGAGG - Intergenic
901350124 1:8588039-8588061 TTACAGTGCATGGCACATAGTGG - Intronic
901448103 1:9320214-9320236 GAACAATGCTTGGCACACAGTGG - Intronic
902225560 1:14994346-14994368 GTACAATGTATGGCGCAATGAGG - Intronic
902661716 1:17908935-17908957 GTACAATACCTGGCATAAAGTGG + Intergenic
905627985 1:39501037-39501059 CTTCAATTCATGGCAGAAAGTGG + Intronic
905996708 1:42387595-42387617 GTACAATGCCTGGCACAGAGTGG - Intronic
906946907 1:50302156-50302178 GTAAAATGCCTGGCATATAGTGG + Intergenic
907578358 1:55549621-55549643 AGAAAATGCATGGGAAAAAGAGG - Intergenic
907775646 1:57511692-57511714 GTACAATGCCTAGCACATAGTGG + Intronic
908411040 1:63865726-63865748 GTACAGTGCTTGGCACATAGCGG + Intronic
908572483 1:65423929-65423951 GTAAAGTGCTTGGCAAAAGGAGG - Intronic
908942992 1:69459242-69459264 CTACAATGCATGGTAAAAATAGG - Intergenic
908991157 1:70091364-70091386 GTAAAATGAAAGACAAAAAGAGG - Intronic
910424959 1:87112463-87112485 GTGCAGTGCCTGGCAAACAGTGG - Intronic
911369038 1:96974341-96974363 GTACTTTACATGGCAAAAGGAGG - Intergenic
912970107 1:114273349-114273371 GTAGAAGGGATGGCAAAGAGTGG - Intergenic
913310381 1:117484608-117484630 GTTCACTGCATAGCAAAAAGAGG + Intronic
916040556 1:160957609-160957631 GCACAATGCCTGGCACACAGTGG + Intergenic
916379300 1:164190850-164190872 GTATATTCCATGGCAAAAATGGG + Intergenic
918371499 1:183866257-183866279 GCACAATGCCTGGCAGACAGTGG - Intronic
920246364 1:204590511-204590533 GCACAATGTATGGCAAAAGCAGG + Intergenic
920447631 1:206031233-206031255 GAGCAGTGCATGGCATAAAGTGG - Intergenic
921193247 1:212728297-212728319 GTACAATTCCAGGCATAAAGTGG + Intronic
921516163 1:216095034-216095056 GAATAATGCCTGGCACAAAGAGG + Intronic
921617037 1:217281096-217281118 GTACAAAGCATGATAAAAATTGG + Intergenic
1068313625 10:55312463-55312485 ATACAGTGCATGGCATAATGTGG - Intronic
1069626817 10:69873228-69873250 GTATAATCCATGTCTAAAAGGGG - Intronic
1070341730 10:75504305-75504327 GCATAATGCATGGCACATAGAGG - Intronic
1070744801 10:78927317-78927339 GTGCAGTGCATGGCACACAGAGG + Intergenic
1071410714 10:85391105-85391127 GTAAAATGAATGGCAAAAACAGG + Intergenic
1071532819 10:86401975-86401997 GTACAATTTATGGTAGAAAGAGG + Intergenic
1072316219 10:94205921-94205943 GAACAGTGCATGGCACACAGTGG - Intronic
1072739744 10:97902250-97902272 GTAAAATGCCTGGCACAGAGTGG + Intronic
1073648389 10:105331707-105331729 GAACAATGCAGAGCATAAAGTGG + Intergenic
1078058091 11:8023782-8023804 GTAAAATGACTGGCACAAAGTGG + Intronic
1078851539 11:15168579-15168601 GCACACTGCATGGCACAAAAGGG - Intronic
1079015473 11:16865230-16865252 GTACAATGCATAGAGAAAGGGGG - Intronic
1080445031 11:32330916-32330938 GCACAATGCCTGGCACACAGTGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1085839141 11:79990542-79990564 GCACAATGCTTGGCACAGAGTGG - Intergenic
1086061354 11:82702907-82702929 CTACCATTCATGGGAAAAAGAGG + Intergenic
1087043242 11:93821846-93821868 GTACAATGCCTGGCACATAGTGG + Intronic
1087847669 11:102991620-102991642 GTACTATGGAAGGCATAAAGAGG + Intergenic
1087885249 11:103473109-103473131 GTACACTGCATTTCAAATAGAGG - Intronic
1088045886 11:105449898-105449920 GCACAATATCTGGCAAAAAGTGG + Intergenic
1088214122 11:107489290-107489312 GCACAATGCCTGGCACACAGTGG + Intergenic
1088793507 11:113247673-113247695 GTACATTGCATGAAATAAAGTGG + Intronic
1088890987 11:114044097-114044119 GGACAATGGTTGGCATAAAGAGG - Intergenic
1089111343 11:116060168-116060190 GTGCAATGCAAGGAAGAAAGAGG + Intergenic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1093345102 12:18031072-18031094 TTAAAATGCATGGCAAAAAGAGG - Intergenic
1093807697 12:23454911-23454933 GGGCAGTTCATGGCAAAAAGTGG - Intergenic
1094078363 12:26503848-26503870 GTACAATTGATGACATAAAGAGG + Intronic
1099138879 12:78944249-78944271 GTACTACACATGGCAAGAAGGGG - Intronic
1099326401 12:81220720-81220742 GTAAAATGTTTGTCAAAAAGTGG - Intronic
1099889921 12:88579044-88579066 GGACATTGCCTGGCTAAAAGAGG - Intronic
1100201172 12:92299336-92299358 GTAGAATGCATGGCAAGGATAGG - Intergenic
1100666201 12:96756114-96756136 GGAGAATGCATGTCAAAAAAGGG + Intronic
1100760837 12:97805021-97805043 GTATAATGCCTGGCACATAGTGG + Intergenic
1101440955 12:104704044-104704066 GTCCAATGCCTGGCACCAAGTGG + Intronic
1102157821 12:110744463-110744485 GAACAATGCCTGGCACAGAGTGG - Intergenic
1103174448 12:118850159-118850181 GTACAGTGCCTGGCATATAGTGG + Intergenic
1106160601 13:27198002-27198024 ATACAATGAATGAAAAAAAGAGG - Intergenic
1107583844 13:41822414-41822436 CTACACTGCATAGGAAAAAGGGG - Intronic
1107620276 13:42221092-42221114 GTAACTTGCATGGGAAAAAGTGG + Intronic
1108741469 13:53343178-53343200 GAACAATGGATGGCAAAAGCAGG + Intergenic
1110408342 13:75175784-75175806 CTACAATGCATTGCAAGAGGAGG + Intergenic
1114395714 14:22358504-22358526 GTACACTGGATAGAAAAAAGTGG - Intergenic
1115750180 14:36481619-36481641 GCACAATGCCTGGCACACAGTGG + Intronic
1116429540 14:44830015-44830037 CTAAAATGCCTGGCAAAAATAGG - Intergenic
1117357634 14:54940776-54940798 GTATAATGCAGAGCAAAATGGGG + Exonic
1119112609 14:71989111-71989133 GCCCAATGCCTGGCACAAAGTGG - Intronic
1120516473 14:85476791-85476813 GGAAAATGCATGGGAAAAAGTGG + Intergenic
1121837214 14:97102698-97102720 GCAGAATGCTTGGCAAAGAGGGG - Intergenic
1121943726 14:98098402-98098424 GGACAAAGCATTGCAAAAAGAGG - Intergenic
1121986322 14:98510007-98510029 ATACACTGCATCACAAAAAGAGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1125063410 15:35452284-35452306 GTACAATGCCTGGATAAAACAGG + Intronic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1128682971 15:69664871-69664893 TTACGGTTCATGGCAAAAAGGGG + Intergenic
1129267156 15:74399906-74399928 CTGGAATGCATGCCAAAAAGGGG - Intergenic
1131393982 15:92071980-92072002 GTACAATTAATGGCACAAATCGG + Intronic
1131819650 15:96259126-96259148 GTAAAATGGATGGAAGAAAGAGG + Intergenic
1137526627 16:49242008-49242030 GTACAATTCATTGCAATGAGAGG + Intergenic
1137966687 16:52941722-52941744 GTACAATGCCTGGCACATAATGG + Intergenic
1138802014 16:60044596-60044618 GCAAAATGCATGGCTGAAAGTGG + Intergenic
1140507951 16:75486191-75486213 GTACAATGCAGGGCAGAGTGGGG - Intronic
1141468689 16:84223797-84223819 GAACCATGCCTGGCACAAAGTGG - Intronic
1145053555 17:19682749-19682771 CTACCATGCATGGCAAACAGTGG + Intronic
1147800224 17:43080215-43080237 GTACAATGCTTAGCACACAGTGG - Intronic
1155413548 18:25571760-25571782 GTGCCATCCATGGCTAAAAGGGG - Intergenic
1155453844 18:25990097-25990119 ATACAATGCTTGGCAGCAAGTGG + Intergenic
1155571870 18:27203300-27203322 GCAGAGTGCATGGTAAAAAGAGG + Intergenic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1157464990 18:47936064-47936086 GCACAATCCATGGCACTAAGTGG - Intergenic
1157526848 18:48389812-48389834 GTACAGTGCCTGGCACGAAGAGG + Intronic
1158998665 18:62950556-62950578 GTAGAATGGATGGAAGAAAGTGG + Intronic
1161604924 19:5209461-5209483 GTACATTGGATGGCAAATGGTGG - Intronic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1166992058 19:46698498-46698520 GTACAGTGCCTGGCATACAGAGG + Intronic
1168598741 19:57700980-57701002 GTACAAACCAAGGCAATAAGAGG + Exonic
925554407 2:5114201-5114223 GCACAAGTCATGGCTAAAAGAGG + Intergenic
925766567 2:7242110-7242132 TAACAATGCCTGGCAATAAGTGG - Intergenic
926307841 2:11652109-11652131 GTAAAATGCCTGGCACAGAGTGG - Intergenic
926421425 2:12703592-12703614 GTATAATGCATGTCCCAAAGTGG + Intergenic
929555722 2:42924569-42924591 GCACAATGCCTGGCACAGAGTGG + Intergenic
931570263 2:63661477-63661499 GTACAATGCATGGCAAAAAGTGG + Intronic
932943350 2:76196056-76196078 GTACATTGCATTGCTAATAGTGG - Intergenic
933023708 2:77226740-77226762 ATTCAATGTATGTCAAAAAGAGG - Intronic
936804198 2:116306762-116306784 GTAAAATTCTTGGCATAAAGAGG + Intergenic
940088780 2:149893610-149893632 GTACCAGGCATGGGTAAAAGAGG + Intergenic
940614374 2:156032062-156032084 GTACAGTTCATGCTAAAAAGGGG - Intergenic
940685003 2:156837856-156837878 GCATCTTGCATGGCAAAAAGAGG - Intergenic
940884111 2:158973944-158973966 GAACAAAGCATGGCAGAGAGAGG - Intronic
941089111 2:161154097-161154119 GCATAATGCATGTCATAAAGAGG + Intronic
941151386 2:161919265-161919287 GCACAATGAATGGCAGAAGGAGG + Intronic
941294317 2:163717107-163717129 CTAAAATGCATGATAAAAAGAGG + Intronic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
943960908 2:194262765-194262787 GGACAATGCATTGCAAGCAGAGG + Intergenic
946497294 2:220207396-220207418 GTACAGTGCCTGGAAGAAAGTGG + Intergenic
946572671 2:221041842-221041864 CCACAATGCATGACATAAAGTGG + Intergenic
946581727 2:221135617-221135639 GAACAATGCCTGGCATATAGGGG + Intergenic
947182202 2:227421292-227421314 GTACAGTGCTTGGCACACAGTGG - Intergenic
1171017003 20:21551154-21551176 GCACAGTGCATGGCACACAGAGG - Intergenic
1172160685 20:32866000-32866022 GTAGAATGCATAGGAAGAAGAGG + Intronic
1173836077 20:46126774-46126796 GAACACTGGATGGGAAAAAGGGG + Intronic
1173957376 20:47044341-47044363 GAACAATGCCTGGCACACAGTGG - Intronic
1174569898 20:51494019-51494041 GTACAGTGCCTGGCAAAGAGTGG + Intronic
1175256313 20:57649670-57649692 GTACAAACCTTGGCAAAAAAAGG + Exonic
1177048623 21:16203156-16203178 GTACATTGCATGACAAAAGCAGG - Intergenic
1177639303 21:23825980-23826002 TTACAATACATGGCAAAATGAGG - Intergenic
1178782174 21:35614189-35614211 GTACTTTGCATGGCCAAAGGAGG + Intronic
1181663764 22:24375049-24375071 GAACAATGAATGCCAAAAATTGG + Intronic
1181978191 22:26747405-26747427 GAACAATGCCTGGCATACAGTGG - Intergenic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1184386756 22:44181154-44181176 GAACAATGCTTGGCACAAAGTGG - Exonic
951755628 3:26087872-26087894 GTCCCAACCATGGCAAAAAGAGG - Intergenic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
955786264 3:62542650-62542672 GTAATATGAATGGCCAAAAGAGG + Intronic
956332915 3:68131043-68131065 GGATAATGCATGGCATATAGTGG + Intronic
959282760 3:104366350-104366372 GTATAATGCATTGGAAAAAAAGG - Intergenic
960183947 3:114615943-114615965 GTACATTGCATGGCAAAGAAAGG - Intronic
960194622 3:114749867-114749889 GTAAAATGCTTGGCACAGAGAGG + Intronic
965388686 3:168077225-168077247 GCAGAATGCATGGCAGAATGTGG - Intronic
967271682 3:187738232-187738254 GGAGAATGGAAGGCAAAAAGAGG - Intronic
967596669 3:191332946-191332968 ATGCACTGCATGGCTAAAAGTGG - Intronic
968717053 4:2168100-2168122 GTACAATGCCTGGGACATAGTGG - Intronic
969112077 4:4850446-4850468 GTACAAAGCCTGACATAAAGAGG - Intergenic
969616431 4:8255581-8255603 GTACAATGCAATACACAAAGAGG + Intergenic
972094704 4:35334320-35334342 GCTCCATTCATGGCAAAAAGGGG - Intergenic
973128521 4:46619841-46619863 GTGCAGTACATGGCAAAAATTGG - Intergenic
978631013 4:110744672-110744694 GTAAAATACATGGTAAAAATGGG - Intergenic
979338755 4:119494425-119494447 TTACAAAGCATGGCAAAATGAGG + Exonic
979901883 4:126230976-126230998 GTTCAACTCATGGCAGAAAGTGG - Intergenic
980382128 4:132035745-132035767 GTACAATGAATGGCCAGCAGTGG - Intergenic
980907289 4:138960973-138960995 GTACAAAGCATGGCATAAACTGG + Intergenic
982293036 4:153798586-153798608 GAACAAGGAATGGCAAAAAGAGG + Intergenic
982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG + Intergenic
984323350 4:178222708-178222730 GTCCAATGCCTGGTATAAAGTGG + Intergenic
988768914 5:34411382-34411404 TTACAAGGCTTGGGAAAAAGGGG - Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990548773 5:56851277-56851299 GCACAATGCCTGGCACACAGGGG - Intronic
992668609 5:79036160-79036182 GTATACTGCATGGCACATAGTGG + Intronic
993408652 5:87546396-87546418 ATACAGTGCATGGTAAAAATGGG + Intergenic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
995915467 5:117240577-117240599 GCACATTACATGGCAAAAGGAGG - Intergenic
996682455 5:126242673-126242695 GTACCATGCATAGCAAAAGTGGG + Intergenic
998458374 5:142291258-142291280 ACACAATGCATGGCACACAGTGG - Intergenic
999046185 5:148472267-148472289 GCACAATGCCTGGCACACAGTGG + Intronic
999993976 5:157074477-157074499 GTACAATGCTTGGCTTACAGTGG - Intergenic
1001947382 5:175791167-175791189 CTTCAATTCATGGCATAAAGTGG - Intergenic
1002036056 5:176470871-176470893 GTAAAAAGAATGGGAAAAAGTGG - Intronic
1002885505 6:1290199-1290221 TTACAGTGCTTGGCAAAGAGTGG - Intergenic
1002950329 6:1803508-1803530 CTACAATTTATGGCAAAAGGTGG + Intronic
1003164277 6:3662602-3662624 GTAAACTGCAAGGGAAAAAGTGG + Intergenic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1004570340 6:16838785-16838807 GTCGAATGCAGGGCAAAATGTGG + Intergenic
1005096146 6:22118707-22118729 GCACAATGCATGGCACACAACGG - Intergenic
1005213089 6:23492189-23492211 GTGCAATGCATGGCAAGGGGAGG + Intergenic
1005648404 6:27864428-27864450 GTACAAGGAATAGGAAAAAGCGG + Intronic
1010873733 6:81074692-81074714 ATACAATGCTTGGCAAATGGTGG + Intergenic
1011418546 6:87148688-87148710 GTTCAATGCCTGGCACATAGTGG - Intergenic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1012501106 6:99889037-99889059 GCACAAAGCAGGGCAAAAAGAGG - Intergenic
1014570601 6:123003026-123003048 GTACATATCATGGCAAATAGGGG + Intronic
1014624212 6:123705697-123705719 GTGCTATGCATGGCACAAACTGG - Intergenic
1017516149 6:155157271-155157293 GAACAAGGCAGGGCAAAAGGAGG - Intronic
1017786524 6:157761544-157761566 GTACCCTGCACAGCAAAAAGGGG + Intronic
1019882742 7:3877230-3877252 CTCCAATGCATGGAAAAAACAGG - Intronic
1022352279 7:29577506-29577528 GTCCCAGGCATGGCTAAAAGGGG + Intergenic
1023728926 7:43171610-43171632 GTACAATGAAAGGAAAAAAGGGG + Intronic
1025775550 7:64557898-64557920 GTACTATGCATAGCATAAACAGG - Intronic
1028821831 7:95220633-95220655 GTACATTGCTTGGCATATAGTGG - Intronic
1030631281 7:111898579-111898601 GTAAAATGCTTGGCATATAGTGG + Intronic
1030964085 7:115967431-115967453 GCACAATGCATGCAAAAAATTGG + Intronic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1035036835 7:155901167-155901189 ATACAATGTATGGTAACAAGTGG + Intergenic
1035651746 8:1271356-1271378 GCACAATGCATGGCACACACTGG + Intergenic
1036062675 8:5341919-5341941 GCACAATGCATGGCACATACAGG - Intergenic
1036237641 8:7054707-7054729 TTACAATGAGAGGCAAAAAGTGG - Intergenic
1037583254 8:20259099-20259121 GTGTATTGCATGGCAAAAAAAGG - Intronic
1038550968 8:28468383-28468405 TCACACTGAATGGCAAAAAGAGG + Intronic
1039719529 8:40148100-40148122 GCACAGTGCATGGCAAAAGGAGG + Intergenic
1042581023 8:70279359-70279381 GTACAATCAATGGCATAGAGTGG + Intronic
1043825697 8:84926025-84926047 TTGCAATGGATGGGAAAAAGTGG + Intergenic
1045362742 8:101448368-101448390 GTTCAATGCATGACACACAGTGG - Intergenic
1046519316 8:115303709-115303731 GTTAAATGCATGGCTAAATGTGG + Intergenic
1047511483 8:125519433-125519455 ATACATTTCATGGCCAAAAGTGG + Intergenic
1048754733 8:137726273-137726295 TTTCAAGGCATAGCAAAAAGGGG - Intergenic
1049033178 8:140052092-140052114 GCACAAGGCATGGCAAAGAGGGG + Intronic
1049465013 8:142747113-142747135 GAATAATGTATGGCTAAAAGGGG + Intergenic
1050226713 9:3466062-3466084 GTACTATGCATGGCATAAATAGG - Intronic
1050296455 9:4210063-4210085 GTATAATGCCTGGCACATAGTGG + Intronic
1052403517 9:28030779-28030801 GTACAATTAAGGGCAAAAAGTGG + Intronic
1054971608 9:71094308-71094330 GTACAATGGTTGGCAAATGGAGG - Intronic
1055312069 9:74993087-74993109 GTACAAAGCCTGGCAAACAATGG - Intronic
1055768599 9:79691992-79692014 GCAGAATGCCTGGCAAATAGTGG + Intronic
1056547470 9:87624726-87624748 GTACAGTTGATGGCAAAAAATGG - Intronic
1057970428 9:99551976-99551998 GAACAATGCATGGAAGAAAAAGG + Intergenic
1057988794 9:99745364-99745386 GCAAAATTCCTGGCAAAAAGTGG - Intergenic
1057999656 9:99851914-99851936 GTACAATGCTTGGTACATAGTGG - Intronic
1059315049 9:113417164-113417186 CAACAATGCATGGCAAGTAGTGG + Intronic
1059857701 9:118418495-118418517 GCACAATGTTTGGCAAACAGTGG + Intergenic
1060467750 9:123922329-123922351 GAAGAATGCATGGAAAAAAATGG - Intronic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1193958574 X:87894687-87894709 GTATAATGGATGGCAAATATGGG + Intergenic
1195018798 X:100805185-100805207 GCAAAATGCATAGCCAAAAGAGG + Intergenic
1195664705 X:107418402-107418424 ATACATTGCATTGCAAAAACAGG + Intergenic
1195750354 X:108157679-108157701 GTACAATGCATGGTTGAGAGAGG - Intronic
1196262884 X:113606037-113606059 GTACTGTGCATGGCACATAGCGG - Intergenic
1197318618 X:125000129-125000151 TTACAATGCACTGCAAAAATGGG - Intergenic
1201012998 Y:9567745-9567767 GTACACTGCATAGCAAAATAAGG + Intergenic