ID: 931570961

View in Genome Browser
Species Human (GRCh38)
Location 2:63668694-63668716
Sequence TTCAGTTTACCCTGGAAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931570961 Original CRISPR TTCAGTTTACCCTGGAAAGC GGG (reversed) Intronic
901096312 1:6682941-6682963 TTCAGCTTGCCCTTTAAAGCAGG + Intronic
901423575 1:9166780-9166802 TTCAATGTACCCTGGGAAGGCGG + Intergenic
902199276 1:14821775-14821797 CCCAGTCAACCCTGGAAAGCTGG + Intronic
902807923 1:18872410-18872432 TACACTTTACCCTGGACACCTGG + Exonic
903293007 1:22326501-22326523 ATCAGATTTCCCTGGAAAGCCGG + Intergenic
906953706 1:50355042-50355064 TTCTGTTCTCCCTGGTAAGCTGG + Intergenic
907087250 1:51686916-51686938 TTCAGTCTTCTTTGGAAAGCAGG - Intronic
908877868 1:68698393-68698415 GTCATTTTCCCCTTGAAAGCTGG - Intergenic
909766402 1:79361227-79361249 TTCACTTGACCCTGTAAAGACGG + Intergenic
912510714 1:110188491-110188513 TTCTGTTTTCCCTGTAAAGCAGG - Intronic
913112185 1:115666598-115666620 TTCAGTTCTCCCTGGGGAGCTGG - Intronic
913163273 1:116164545-116164567 TCCACATTACCCTGCAAAGCTGG + Intergenic
913163602 1:116166592-116166614 TCCACATTACCCTGCAAAGCTGG + Intergenic
915438288 1:155926209-155926231 TTCATTATACCGTGGAGAGCTGG + Intronic
917038371 1:170774578-170774600 TTCAGTTTTCTCAGTAAAGCTGG + Intergenic
917095339 1:171393893-171393915 TACAGTGTATCCTGGAGAGCAGG + Intergenic
917529029 1:175816345-175816367 ATCAGTCCACCCTGGAAAGCGGG + Intergenic
920685180 1:208103856-208103878 TTCAGTCTTGCCTGGAAAGTGGG + Intronic
921455806 1:215370155-215370177 TTCTGTTTTCTCTGGAAAGTAGG - Intergenic
922219403 1:223546670-223546692 TTCAGTTTCTCCTGGAAAATGGG - Intronic
922486833 1:225979869-225979891 TTCGGTTTTCCCTGGAATACAGG - Intergenic
923268366 1:232333639-232333661 TTCAGGGTCCCCTGGAGAGCTGG - Intergenic
924728537 1:246691894-246691916 TTCAGTTGTCCCTTGAAATCTGG + Intergenic
1062994819 10:1855887-1855909 TTCAGTTCACCTTGGAGGGCTGG - Intergenic
1064361126 10:14665774-14665796 TTCAATTTGCACTGGGAAGCAGG - Intronic
1064827035 10:19416071-19416093 TTCAGTTTATCCTGGAAGTTAGG - Intronic
1066073111 10:31841531-31841553 ATCTGTTTACCCTGGTAATCAGG - Intronic
1067595988 10:47558270-47558292 TTCAGTTTCCTCTGGTGAGCTGG + Intergenic
1067680797 10:48439047-48439069 TACAGTTTATCCTGGTCAGCAGG + Exonic
1067957785 10:50811921-50811943 TTCAGTAGACTGTGGAAAGCAGG + Intronic
1068548538 10:58380239-58380261 TTAAATTTACCTGGGAAAGCAGG - Intergenic
1070943765 10:80371356-80371378 TTCAGTTTACCTGGGAGAGCAGG - Intergenic
1072026054 10:91458435-91458457 TTCAGATTTACCTGGAAAGGCGG + Intronic
1072364326 10:94693638-94693660 TTTATTTTAGCCTGGAAGGCAGG - Intronic
1074543238 10:114383773-114383795 TTCTCTTTGCCCTGGAAAGTTGG + Intronic
1084988416 11:72899248-72899270 TGCAGTTTACTCTGCAAAGAGGG - Intronic
1087427749 11:98012539-98012561 TCCATTTTCCCCTGGAAAGAAGG + Intergenic
1087547255 11:99600544-99600566 GGCAGTTTGCCCTGGGAAGCTGG - Intronic
1088446786 11:109939286-109939308 TTCAGGTAACAGTGGAAAGCTGG + Intergenic
1088550367 11:111006487-111006509 TTCATTTTTCTCGGGAAAGCAGG - Intergenic
1089807298 11:121102608-121102630 TTCTGTTTACTCTGGCAAGCTGG + Intronic
1090513099 11:127396372-127396394 TCAAGTTTTCCCTGGAAAACTGG - Intergenic
1091128400 11:133122784-133122806 TCCAGTTTACCTGGGACAGCAGG - Intronic
1091294438 11:134463737-134463759 CTCAGTGTACCCTGGGAACCTGG - Intergenic
1094021652 12:25921175-25921197 TTCAGAAAACTCTGGAAAGCAGG - Intergenic
1097161837 12:57051845-57051867 TTCAGTTTTGCCTAGAAAGCAGG - Intergenic
1097678338 12:62626210-62626232 TTCAGTTTATCATGGGCAGCTGG + Intergenic
1099281137 12:80647842-80647864 TTATGTTTACCCTGAGAAGCTGG + Intronic
1099978643 12:89572476-89572498 TTAAGATTACCCTTGAAAGATGG - Intergenic
1100184227 12:92121666-92121688 TACAACTTACGCTGGAAAGCTGG + Intronic
1101530581 12:105569759-105569781 ATCACTTGAGCCTGGAAAGCAGG - Intergenic
1101685493 12:107015768-107015790 ATCACTTTAGCCTGGAAAGTTGG - Intronic
1105449039 13:20482451-20482473 ATAAGTTTACTCTGAAAAGCTGG - Intronic
1106512580 13:30424056-30424078 TTAAGTTTCACATGGAAAGCTGG + Intergenic
1108987168 13:56606530-56606552 TTCAATTTTCCCTAGAATGCAGG - Intergenic
1109167876 13:59058078-59058100 CACAGTTTACCCTGCAAAGTAGG - Intergenic
1109218088 13:59613233-59613255 TTCAGATATCCTTGGAAAGCAGG - Intergenic
1112240833 13:97679583-97679605 TCAAGTTTACTCTGGAAAACAGG + Intergenic
1114208262 14:20593624-20593646 TCCAGATTCCCCTGGAAATCTGG - Intronic
1114814039 14:25935438-25935460 TTCATTTTTCTCTGGAAACCTGG + Intergenic
1115898093 14:38113276-38113298 TTCTAGTTACCCTGTAAAGCAGG + Intergenic
1120511143 14:85415870-85415892 TTCAGTTTATCCTGAGAGGCAGG + Intergenic
1122358982 14:101146454-101146476 ATCAGTTTACCCTAGAAATGTGG + Intergenic
1123180797 14:106468286-106468308 TTCAGTTTTACCTGGAATTCTGG - Intergenic
1202946100 14_KI270726v1_random:28372-28394 TTCAGTTTTACCTGGAATTCTGG + Intergenic
1125368776 15:38947732-38947754 TGCAGTCTGCCCTGGAAAGCAGG + Intergenic
1126102171 15:45125350-45125372 TTCAGTATACCCTTGAGAGAAGG - Intronic
1126281521 15:46956978-46957000 TTCAGTTTTTCCTGGAACACGGG - Intergenic
1128081440 15:64859581-64859603 TTCCGTTTACTCTGAAAAGTAGG - Intronic
1128458138 15:67844434-67844456 TTCAAATGACCCTGCAAAGCAGG - Intergenic
1130134982 15:81174891-81174913 TTCAGTTTCCCTTGGAGAGGTGG + Intronic
1132936115 16:2482220-2482242 TCCAGTGTACCCTGGGAAGGAGG - Intronic
1136586822 16:31191679-31191701 TTCAGATTACCCTGCCCAGCAGG + Exonic
1137225275 16:46499197-46499219 TTCAGTTCACCTGGGAAATCTGG + Intergenic
1138850497 16:60623014-60623036 TTTAGTCTAGCCTGGAAATCTGG - Intergenic
1139918033 16:70439862-70439884 TTCACTTTACCCTCAACAGCAGG - Intergenic
1140585222 16:76282601-76282623 TTCAGTTTATTCTAGAAAGTTGG - Intronic
1141954270 16:87359787-87359809 CACAGTTGACTCTGGAAAGCGGG + Intronic
1142985192 17:3691081-3691103 TTCAGGTAACGCTGGAAAGGTGG - Intronic
1144506206 17:15833433-15833455 TTCAATTTACCCTGCAAAGAGGG - Intergenic
1144612566 17:16736054-16736076 TTCAGTTCACCTGGGAAATCTGG - Intronic
1144900162 17:18579224-18579246 TTCAGTTCACCTGGGAAATCTGG + Intergenic
1145118189 17:20231588-20231610 TTCAATTTACCCTGTAAACCAGG - Intronic
1145132284 17:20366441-20366463 TTCAGTTCACCTGGGAAATCTGG - Intergenic
1145170381 17:20651366-20651388 TTCAATTTACCCTGCAAAGAGGG - Intergenic
1146105119 17:30027830-30027852 TTCACTTGCCCCTGGTAAGCAGG - Intronic
1146263461 17:31436341-31436363 TTCAGTTTACCCTCGGATACTGG + Intronic
1149487827 17:57057251-57057273 TTCAGCTTACCCTGTAATTCTGG - Intergenic
1152542459 17:80983094-80983116 TGAGGTTTGCCCTGGAAAGCAGG - Intergenic
1157220536 18:45825845-45825867 TACAGTCTCCCCTGGAAGGCAGG + Intronic
1163742344 19:19023253-19023275 TCCAGTCTAGCCTGGAAAGTTGG - Intronic
1166441098 19:42816046-42816068 TTCTGCTTTCCCTGGAAAGCTGG + Intronic
1166460572 19:42984653-42984675 TTCTGCTTCCCCTGGAAAGCTGG + Intronic
1166477872 19:43144626-43144648 TTCTGCTTCCCCTGGAAAGCTGG + Intronic
1167762984 19:51461031-51461053 TTCCCTTTGCCCTGGGAAGCTGG - Intergenic
1168331111 19:55569493-55569515 TTGAGTTTTCTCAGGAAAGCAGG + Intergenic
930734983 2:54769000-54769022 TTCAGCTTTCAGTGGAAAGCTGG + Intronic
931570961 2:63668694-63668716 TTCAGTTTACCCTGGAAAGCGGG - Intronic
934245404 2:90301215-90301237 TTCAGCTTACAGCGGAAAGCCGG + Intergenic
934263341 2:91495814-91495836 TTCAGCTTACAGCGGAAAGCCGG - Intergenic
934764779 2:96874583-96874605 TTCACTTTTCTCTGGAAACCTGG - Intergenic
936927550 2:117752981-117753003 TTCAGATCCCCCTAGAAAGCAGG - Intergenic
940185366 2:150978556-150978578 TTCATTTTATCTTGCAAAGCAGG + Intergenic
940791723 2:158036302-158036324 TTCACTTGAACCTGAAAAGCAGG + Intronic
941819833 2:169833063-169833085 TTCAGTATACCCTGAAGAGTGGG - Intronic
942623719 2:177876571-177876593 TTGAGTTTACACTGTAAACCAGG + Intronic
948693962 2:239723397-239723419 GGCAGTTGGCCCTGGAAAGCAGG - Intergenic
1169928437 20:10807190-10807212 CTCAGGTTACCCTGGAGATCAGG + Intergenic
1170596844 20:17811860-17811882 CTCAGTGGACCCTGGAAAGGAGG - Intergenic
1172590705 20:36115951-36115973 CTCAGTTTCCCCTGGAAAATGGG - Intronic
1173373799 20:42463983-42464005 TTTATTTTTCCCTGGAGAGCAGG - Intronic
1174131118 20:48343986-48344008 TTCAGTCTACCTGGGAAAGAGGG + Intergenic
1174855268 20:54038657-54038679 TTCAGTTTAAAGGGGAAAGCAGG + Intronic
1175543955 20:59766119-59766141 CTCAGTTTCCCCTGTAAAGCTGG + Intronic
1177891337 21:26807662-26807684 TTCAGTTTAGGCTGCCAAGCTGG + Intergenic
1178327202 21:31655643-31655665 TGCTGTTTACCAAGGAAAGCAGG - Intergenic
1180076403 21:45465577-45465599 TTCTCTTTTCCCTGGAAAGTGGG + Intronic
1182367442 22:29788670-29788692 TCCCCTTTACCCTGGACAGCAGG - Exonic
1184409119 22:44316441-44316463 ATCAGAACACCCTGGAAAGCTGG - Intergenic
949185647 3:1188271-1188293 TTCAGTTCATTCTGGAAAGGAGG - Intronic
949185731 3:1189316-1189338 TTCAGTTCATTCTGGAAAGGAGG + Intronic
949692662 3:6657903-6657925 TTCTGTTTACCCTGGAAGCATGG - Intergenic
949891394 3:8736236-8736258 CTCAGTTTCCCCTGTAAAGTGGG + Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
950058576 3:10049809-10049831 TTAAATTTAGCCTGGGAAGCTGG + Intronic
950654750 3:14429632-14429654 TTCAGATTCACCTGGGAAGCTGG + Intronic
954066780 3:48113026-48113048 GTCTGTTTACCCTGCAAAGGGGG + Intergenic
958831709 3:99098351-99098373 TTCAGTTTTATCAGGAAAGCAGG + Intergenic
962806575 3:138931671-138931693 TTGAGACTACCCTGGCAAGCTGG + Intergenic
965608782 3:170523253-170523275 TTCAGTTTAGACTTGAAACCTGG - Intronic
965721182 3:171664425-171664447 TGCAGATTACACTGGAAAGAAGG + Intronic
966666250 3:182474393-182474415 ATCAGTTCACTTTGGAAAGCCGG + Intergenic
967329134 3:188273099-188273121 TTCAGCCTACCCAGTAAAGCAGG + Intronic
967706602 3:192658555-192658577 TTAGCTTTACCCTAGAAAGCAGG + Intronic
971371395 4:26022201-26022223 TGCTGTTTCCCCTGGACAGCCGG + Intergenic
975286618 4:72628856-72628878 TTCATTCTACCTTGGAAATCAGG - Intergenic
975720878 4:77247617-77247639 TTGAGTTTACTCAGGAAAGGAGG - Intronic
975724060 4:77275235-77275257 TTGAGTTTACTCTGGAAGGGAGG - Intronic
978904631 4:113991242-113991264 TTGAGTGTTCCCTGGAAACCAGG + Intergenic
980935145 4:139219230-139219252 ATCACTTGAACCTGGAAAGCAGG - Intergenic
983426509 4:167590461-167590483 TTCACTTTACCCATGAAAGCGGG + Intergenic
985140458 4:186834260-186834282 TTCAGTGTTCTCTGGAAAGGAGG - Intergenic
986027090 5:3860732-3860754 TTCAGTGTACCAGAGAAAGCTGG - Intergenic
986073477 5:4310981-4311003 TTCATTTCACCCTGAAAAGCGGG - Intergenic
986168631 5:5297346-5297368 TCCAGTCTTCCCTGGAAAGTGGG + Intronic
987167632 5:15217893-15217915 TTCATTCTACCATGGGAAGCAGG + Intergenic
989052450 5:37334815-37334837 TTTAGTTGATCCTGGAAAGATGG - Intronic
992050643 5:72937482-72937504 TTCACTTTACTCTGGAAACGTGG - Intergenic
995335493 5:110994210-110994232 CTCAGTTTACTCTGGAAAATTGG - Intergenic
995411006 5:111857143-111857165 TGCAGGTTTCCCTGGAAAGCAGG + Intronic
995859867 5:116629730-116629752 TTAAGTTTACCTAGGAAAACAGG + Intergenic
996187753 5:120499931-120499953 TTCTGTTAACACTGGAAAGAGGG + Intronic
997076959 5:130690259-130690281 TTCAGTTTACCCTTTAATGCTGG - Intergenic
997255664 5:132426281-132426303 TTCAGCTCAGCCTGGAAAGGAGG - Intronic
997331482 5:133065757-133065779 TTTAGTTTACTCTGTAAACCAGG + Intronic
999634873 5:153611328-153611350 TTCTTTTTTTCCTGGAAAGCTGG + Intronic
1000261751 5:159595029-159595051 TTTTGTTTACTTTGGAAAGCAGG + Intergenic
1000501220 5:162053406-162053428 TTCAGTATACTCTGCAAAGGAGG - Intergenic
1001504642 5:172268397-172268419 CTCTGTTTTCCCTGGAAATCAGG - Intronic
1005640602 6:27792663-27792685 TTCAGTGTTTTCTGGAAAGCTGG + Intergenic
1006515326 6:34542224-34542246 TGCAGCTTTCCCTGGGAAGCAGG - Intronic
1007057705 6:38904155-38904177 CTCACTTTACCCTTCAAAGCTGG - Intronic
1008376107 6:50794154-50794176 TTCAGTTTATTCTGTAAATCAGG - Intergenic
1010927269 6:81757492-81757514 TTCAGTTTACTCTGCAAAGAAGG - Intergenic
1010968301 6:82237229-82237251 TTCAGTTTCTGCTGGAAAGTTGG - Intronic
1011432043 6:87297871-87297893 TTCACTTGACCCTAGAATGCAGG + Intronic
1011677309 6:89747431-89747453 TTCAGTGTTTGCTGGAAAGCAGG - Exonic
1012686546 6:102257946-102257968 TTAAGTTTACACTTGAAAGAGGG - Intergenic
1016747002 6:147591662-147591684 TTCAGTTTTCCATGGAAATGGGG + Intronic
1021583581 7:22183640-22183662 TGCAGTTTACACAGGAAAACCGG + Intronic
1021808209 7:24377504-24377526 TTCACTTTCCCCTTGAAAGCTGG + Intergenic
1023231579 7:38036673-38036695 TTCAGTTTTCTTTGGAAAGAAGG - Intergenic
1023321639 7:39004642-39004664 CACAGTTTAACCTGGAAAGTTGG + Intronic
1024950964 7:54860068-54860090 TTCACTTTACCTGGCAAAGCTGG + Intergenic
1031922712 7:127613485-127613507 TTCAGTGGCCCGTGGAAAGCTGG - Exonic
1035006949 7:155671010-155671032 GTCAGTTTGCCCTGGGAAACTGG + Intronic
1037059075 8:14483826-14483848 TTCAGTTTAGCCTGAAAATAAGG + Intronic
1039993798 8:42513730-42513752 TTCAGTGTGCCCTGGAAGACAGG + Intronic
1040034568 8:42857831-42857853 TTGAGATCAGCCTGGAAAGCAGG + Intronic
1040100342 8:43495180-43495202 TTCAGTTCACCTGGGAAATCTGG - Intergenic
1040578125 8:48672369-48672391 TTCAGATAACCCTTGAAAACAGG - Intergenic
1040782065 8:51121380-51121402 TACAGTTTCCTCTGGAAAACTGG + Intergenic
1042140327 8:65672048-65672070 TTCACTTTAAGCTGGAAAGTGGG + Intronic
1042302502 8:67300157-67300179 ATCAGTATACCCTGGAAGGAAGG + Intronic
1048271041 8:133028230-133028252 CTCAGGTAACCCAGGAAAGCAGG - Intronic
1053019843 9:34687194-34687216 TTCAATTGACCCTGGAAGCCTGG - Intergenic
1053258634 9:36641529-36641551 TTCTGTGTACCCTGGAGAGGAGG + Intronic
1055952116 9:81739148-81739170 TTCAGTTTATCTTGGATACCTGG + Intergenic
1056437732 9:86589579-86589601 TTCAGTTGGCCCTGAAGAGCTGG - Intergenic
1057866840 9:98688005-98688027 TTCAGACTACCCTGGCAGGCTGG - Intronic
1058623803 9:106913353-106913375 TTAATTTTCTCCTGGAAAGCAGG + Intronic
1060847149 9:126846633-126846655 CTCAGTTTCCCCTGTCAAGCTGG - Intergenic
1061415638 9:130445504-130445526 CTCAGTTTACCCTGGACAGATGG + Intronic
1062007598 9:134248983-134249005 TTCAGCTCCCCCTGGAAAACAGG + Intergenic
1186187937 X:7040220-7040242 TTCTGCTTCCCCTGGAAAGCTGG + Intergenic
1188446315 X:30256561-30256583 TTCAGGTGACCCAGGAAACCAGG - Intergenic
1188523893 X:31069768-31069790 TTTATTTTACCCGGAAAAGCAGG - Intergenic
1193170737 X:78332671-78332693 TTCAGCTTGCCCTGCAAATCTGG + Intergenic
1196256281 X:113522784-113522806 TGCTGTTCACCATGGAAAGCAGG - Intergenic
1197185440 X:123580668-123580690 AGCTGTTTACCCTGGAAATCTGG - Intergenic
1198175219 X:134148168-134148190 TTCAGTTTTCTCTGTAAAGTAGG - Intergenic
1199854540 X:151749893-151749915 TTCTGTTTAGCCTGGAAACAAGG + Intergenic
1201565340 Y:15359535-15359557 TTCAGATTAAAATGGAAAGCCGG + Intergenic
1201622230 Y:15972883-15972905 TATAAATTACCCTGGAAAGCTGG + Intergenic