ID: 931572257

View in Genome Browser
Species Human (GRCh38)
Location 2:63681071-63681093
Sequence GACCGAGATGTACCGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931572246_931572257 27 Left 931572246 2:63681021-63681043 CCCTGAAACCAGCAATGATACCC 0: 1
1: 0
2: 1
3: 7
4: 130
Right 931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 48
931572247_931572257 26 Left 931572247 2:63681022-63681044 CCTGAAACCAGCAATGATACCCT 0: 1
1: 0
2: 0
3: 14
4: 110
Right 931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 48
931572251_931572257 7 Left 931572251 2:63681041-63681063 CCCTAGTTGTACAGCATGGGCCT 0: 1
1: 0
2: 0
3: 9
4: 83
Right 931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 48
931572252_931572257 6 Left 931572252 2:63681042-63681064 CCTAGTTGTACAGCATGGGCCTT 0: 1
1: 0
2: 2
3: 32
4: 124
Right 931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 48
931572248_931572257 19 Left 931572248 2:63681029-63681051 CCAGCAATGATACCCTAGTTGTA 0: 1
1: 0
2: 1
3: 9
4: 76
Right 931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG 0: 1
1: 0
2: 0
3: 6
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931572257 Original CRISPR GACCGAGATGTACCGGCTTC AGG Intronic
904432073 1:30470752-30470774 GACAGAGATAAACCTGCTTCAGG + Intergenic
910724896 1:90328115-90328137 GACTGAGCTGTATTGGCTTCAGG + Intergenic
912035005 1:105301524-105301546 CTCTGAGATGTACTGGCTTCGGG - Intergenic
912127324 1:106555199-106555221 GACTCAGATTTACTGGCTTCAGG + Intergenic
917300579 1:173570165-173570187 GACTCAGATGTGCTGGCTTCAGG - Intronic
1064987531 10:21225998-21226020 CTCAGAGATGTGCCGGCTTCAGG - Intergenic
1071962963 10:90824407-90824429 CTCTGAGATGTACTGGCTTCAGG + Intronic
1074670159 10:115780848-115780870 GACTCAGATGTACTGGTTTCAGG + Intronic
1078244612 11:9562956-9562978 GACTGAGATGTGCCAGCTTCAGG - Intergenic
1085223452 11:74896051-74896073 GCCTGAGATGTCCTGGCTTCAGG + Intronic
1086249738 11:84798687-84798709 GACTGAGATGTGCTGGCCTCAGG - Intronic
1095808145 12:46343605-46343627 CTCTGAGATGTACTGGCTTCAGG - Intergenic
1097568992 12:61308028-61308050 CTCTGAGATGTACTGGCTTCAGG - Intergenic
1099764168 12:86960940-86960962 GACTGAGATGTGCTGGTTTCAGG - Intergenic
1102742758 12:115222764-115222786 AACTGAGATGTACCTTCTTCTGG - Intergenic
1113915705 13:113871900-113871922 TACCAAGATGTACCATCTTCTGG - Intergenic
1116079390 14:40154278-40154300 CTCTGAGATGTACCAGCTTCGGG + Intergenic
1117418348 14:55518966-55518988 CTCTGAGATGTACTGGCTTCAGG + Intergenic
1129867595 15:78921474-78921496 CACAGAGAAGTACAGGCTTCTGG + Exonic
1133262683 16:4561606-4561628 GACCTAGCTGTACAGCCTTCAGG + Intronic
1135672516 16:24387341-24387363 GCCGGAGATGTCCCGGTTTCAGG - Intergenic
1136676597 16:31914024-31914046 CTCCGAGATGTGCTGGCTTCAGG - Intronic
1139072959 16:63405407-63405429 TTCAGAGATGTACAGGCTTCAGG - Intergenic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1152663905 17:81556242-81556264 GACCAAGGTGTCCTGGCTTCTGG - Intergenic
931572257 2:63681071-63681093 GACCGAGATGTACCGGCTTCAGG + Intronic
934560715 2:95311939-95311961 GACCGGGAAGGACCGCCTTCAGG + Intronic
940947729 2:159637072-159637094 CTCTGAGATGTACTGGCTTCAGG + Intergenic
943845100 2:192635165-192635187 CTCAGAGATGTACTGGCTTCAGG + Intergenic
944046156 2:195414115-195414137 CTCTGAGATGTACTGGCTTCAGG + Intergenic
949829271 3:8196933-8196955 TTCAGAGATGTACTGGCTTCAGG - Intergenic
950801092 3:15552356-15552378 GACTCAGATGTGCTGGCTTCAGG - Intergenic
953406318 3:42661666-42661688 GATAGAGATGGACCAGCTTCTGG + Intronic
959409063 3:105997755-105997777 GACTCAGATGTGCTGGCTTCAGG - Intergenic
959443773 3:106412321-106412343 CTCTGAGATGTACTGGCTTCAGG - Intergenic
960016420 3:112894434-112894456 GACTGAGAAGCACTGGCTTCAGG + Intergenic
965349976 3:167599853-167599875 GACCGAGATGTGTTGACTTCAGG - Intronic
976390599 4:84500432-84500454 GATGGAGATGTACCAGCTCCTGG + Intergenic
977341548 4:95764452-95764474 GACAGAGCTGTACTGGCTTCAGG + Intergenic
999280546 5:150362511-150362533 GCCCCAAATGTACCTGCTTCAGG + Intronic
1009039359 6:58158409-58158431 GACTGAGATGTGCTGGCTTCAGG - Intergenic
1009215255 6:60913252-60913274 GACTGAGATGTGCTGGCTTCAGG - Intergenic
1009375282 6:62961023-62961045 GACTGAAATGTGCTGGCTTCAGG - Intergenic
1016623820 6:146143008-146143030 GACTGAGATGTGCTGGCTTCGGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1024042617 7:45567088-45567110 GACCAAGATGCACCTGCTTTGGG + Intergenic
1042413548 8:68492651-68492673 GACCTAGAAGTACTGTCTTCTGG - Intronic
1048981142 8:139703848-139703870 GACCGCGATGGAGCGGCTTCGGG + Intergenic
1190804789 X:53824895-53824917 CTCTGAGATGTACTGGCTTCAGG + Intergenic
1193563381 X:83047661-83047683 GACTGAGATGTGCTGGTTTCAGG - Intergenic
1194257519 X:91652805-91652827 GGCCGAGATGTGCTGGATTCAGG - Intergenic
1196385085 X:115140392-115140414 GACTGAGATGTGCTGGCGTCCGG + Intronic
1197053894 X:122094154-122094176 GACTGACATGTGCTGGCTTCAGG + Intergenic
1197561913 X:128034431-128034453 TACTGAGATGTTCTGGCTTCAGG + Intergenic
1200576177 Y:4891751-4891773 GGCCGAGATGTGCTGGATTCAGG - Intergenic