ID: 931572566

View in Genome Browser
Species Human (GRCh38)
Location 2:63684270-63684292
Sequence ACTTGGGCCTACAGCAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931572566_931572571 -6 Left 931572566 2:63684270-63684292 CCCTTTTTGCTGTAGGCCCAAGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 931572571 2:63684287-63684309 CCAAGTGGTTGCTGCTGAAATGG 0: 1
1: 0
2: 2
3: 15
4: 156
931572566_931572574 14 Left 931572566 2:63684270-63684292 CCCTTTTTGCTGTAGGCCCAAGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 931572574 2:63684307-63684329 TGGGCAAGTTCATGAAACCTGGG 0: 6
1: 4
2: 2
3: 20
4: 194
931572566_931572575 18 Left 931572566 2:63684270-63684292 CCCTTTTTGCTGTAGGCCCAAGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 931572575 2:63684311-63684333 CAAGTTCATGAAACCTGGGAAGG 0: 4
1: 1
2: 1
3: 16
4: 160
931572566_931572573 13 Left 931572566 2:63684270-63684292 CCCTTTTTGCTGTAGGCCCAAGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 931572573 2:63684306-63684328 ATGGGCAAGTTCATGAAACCTGG 0: 5
1: 5
2: 2
3: 12
4: 151
931572566_931572572 -5 Left 931572566 2:63684270-63684292 CCCTTTTTGCTGTAGGCCCAAGT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 931572572 2:63684288-63684310 CAAGTGGTTGCTGCTGAAATGGG 0: 1
1: 0
2: 2
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931572566 Original CRISPR ACTTGGGCCTACAGCAAAAA GGG (reversed) Intronic
901741095 1:11342531-11342553 GCTTGCCCCTGCAGCAAAAATGG - Intergenic
905602328 1:39264208-39264230 CCTTGTGCCTATAGCAAAGAGGG + Intronic
909226634 1:73032910-73032932 ACTTCTGCCTACAGCATAAAGGG - Intergenic
911183856 1:94884396-94884418 CCTTGGACCTACAGTAAAACTGG - Intronic
911403346 1:97405287-97405309 ACTTGGACCTACATAAAGAAAGG - Intronic
911617706 1:100032886-100032908 TCTTGTGCCTAAAGCAAATAAGG - Intergenic
911861579 1:102956822-102956844 ACTTTGGCTTACAGAAATAATGG - Intronic
912247712 1:107978218-107978240 ACCTGGGCCTTCAGCAAGGAAGG + Intergenic
912721426 1:112023637-112023659 ACATGGGCCTATTGCATAAAAGG + Intergenic
915558286 1:156672327-156672349 ACTTAAGCCTACAGGAAAAGAGG - Exonic
916056309 1:161070907-161070929 ACTTGGGACTACAGGAAGGATGG + Intergenic
916292124 1:163178276-163178298 ACTTGGGCCTAGAAAACAAAAGG + Intronic
916436579 1:164783224-164783246 ACTTGGGCAAATAGCAAGAAAGG + Intronic
916948427 1:169754939-169754961 GCTTGGGTCTTCAGCAAAATTGG + Intronic
917242086 1:172959516-172959538 TTTATGGCCTACAGCAAAAAAGG - Intergenic
921187009 1:212678838-212678860 ACTTGGAGCTACAGCAACACGGG - Intergenic
923022529 1:230175707-230175729 ACCTGCTCCTACAGTAAAAATGG - Intronic
923045253 1:230350835-230350857 ACTTGGACCCACAGTGAAAAGGG + Intronic
924083462 1:240423590-240423612 CTTTGGGAGTACAGCAAAAAAGG - Intronic
1064505154 10:16021156-16021178 ACTTGGGCCTACAGTTTAGATGG + Intergenic
1066480627 10:35792347-35792369 ACTGGGGCTTATTGCAAAAATGG - Intergenic
1066809683 10:39312337-39312359 ATTGAGGCCTACAGGAAAAAAGG - Intergenic
1066930097 10:41747847-41747869 ACTGTGGCCTACAGTGAAAAGGG + Intergenic
1068237159 10:54252233-54252255 ACTTGTGGAGACAGCAAAAAGGG - Intronic
1069371531 10:67752743-67752765 ACTTAGGAATACAGCTAAAAAGG + Intergenic
1072970593 10:100013914-100013936 TCTTGAGGCTACAGAAAAAATGG - Intergenic
1075408127 10:122208045-122208067 ACTAGGGCCTAGAGGAAACAGGG + Intronic
1079542283 11:21591043-21591065 ACTTGGGCGTGCAGCAACAGTGG + Intergenic
1079726513 11:23886436-23886458 ACTTGTGCCTAAAGCCCAAAAGG - Intergenic
1081070883 11:38606978-38607000 ACTTGGCCACACAGGAAAAAAGG - Intergenic
1081406185 11:42701121-42701143 ACTTGGGTCTACTCCAAAGAGGG - Intergenic
1082302746 11:50529847-50529869 ACTGTGGCCTACAGTGAAAAAGG + Intergenic
1082308174 11:50610023-50610045 ATTTAGGCCTACAGTGAAAAAGG - Intergenic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1084401504 11:68946511-68946533 CCTTTGGCCCACAGGAAAAAAGG - Intergenic
1085234718 11:75005675-75005697 ACCTGGGCCCACAGCAAATGTGG - Exonic
1087450001 11:98308697-98308719 ACTGGGCCCTACTGAAAAAATGG + Intergenic
1089137752 11:116263259-116263281 ACTTGGGACTCCAGCTAACAAGG + Intergenic
1090688466 11:129151699-129151721 ACTCTGGTATACAGCAAAAACGG + Intronic
1091781717 12:3218147-3218169 ACCAGGGCCCACAGAAAAAATGG - Intronic
1091856428 12:3744295-3744317 ACTGGGGCCTTTAGCCAAAAAGG - Intronic
1093842424 12:23920500-23920522 ACTTGGACCTAAATCAAAATGGG - Intronic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1095030528 12:37269738-37269760 TTTTGGGCCTACGGTAAAAAAGG - Intergenic
1099067373 12:77999553-77999575 CCTTTGGCCTAAAGCAAAAGTGG + Intronic
1101660673 12:106762711-106762733 AATTGTGTCTACAGCTAAAATGG + Intronic
1104849316 12:131863666-131863688 ACTTGGGCCGAGAGCATAGAGGG + Intergenic
1106772710 13:32977951-32977973 AGTTGGGCTTCCAGCAAGAAAGG + Intergenic
1111169619 13:84508550-84508572 AATTGGGACCAAAGCAAAAATGG - Intergenic
1112329006 13:98462629-98462651 ACTTGAGCCGAGAGAAAAAAGGG - Intronic
1115870963 14:37802222-37802244 ACTGGGGCCTGTAGGAAAAAGGG + Intronic
1122652218 14:103232149-103232171 CCTTGGGCCTGGAGCAAAACAGG + Intergenic
1129001071 15:72334503-72334525 ACTTGGGGCTATAGGAAGAAAGG - Intronic
1129020479 15:72513579-72513601 ACTTGGAACTACAGGAAAGAAGG - Intronic
1130876888 15:88022317-88022339 GCTTGGGCGTAAAGCCAAAATGG - Intronic
1132750427 16:1455062-1455084 ACCTGGGCCTTAAGCAAACAGGG + Intronic
1138839997 16:60489000-60489022 ACTTGGTTCTATAGGAAAAAAGG + Intergenic
1143882703 17:10041949-10041971 ACAAGGGCCTACAGCAAATAAGG - Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1146612873 17:34323284-34323306 CCTTTGGGATACAGCAAAAACGG - Intergenic
1150579211 17:66457015-66457037 AGCTGGGCCTACAACATAAAAGG - Intronic
1151364985 17:73611459-73611481 ACTTGGGCGTCCAGCAAGGAGGG - Intronic
1152841045 17:82568420-82568442 ACCTGGGCCTACAGCTATTAGGG - Intronic
1155782389 18:29852494-29852516 ACTTGGGGTTACAGAAAGAATGG - Intergenic
1156918356 18:42488290-42488312 ACTGTGGACTACAGCAACAACGG - Intergenic
1157061200 18:44292740-44292762 ACATGGGCCTTGAGCAACAAAGG + Intergenic
1158552024 18:58444366-58444388 ACTTGGCCCTACAGAAGACAGGG - Intergenic
1159716505 18:71830367-71830389 AAATGGGACTACAGCAACAATGG - Intergenic
1164815366 19:31195654-31195676 ACTTGGATCTACATAAAAAAAGG + Intergenic
1165293871 19:34910231-34910253 TCTTGGGCCTGTAGAAAAAAAGG + Intergenic
1166345988 19:42166128-42166150 TCTTGGGCCTTCTGCAGAAAAGG + Intronic
1167482468 19:49741637-49741659 ACTTGGGCCTAAAGCATGATAGG - Intronic
1167873871 19:52395743-52395765 ACGTTGGCCTAAAGCAACAAAGG + Intergenic
927437579 2:23082661-23082683 ACTTGAGTCCACAGGAAAAAAGG - Intergenic
928773646 2:34732652-34732674 ACTTAGGCCTGCAGGAACAATGG + Intergenic
929543773 2:42842448-42842470 ACTTGGGCCTAGACCCCAAAGGG - Intergenic
931343685 2:61426694-61426716 ACCAGGGCCTTCAGCAAACATGG + Intronic
931526278 2:63158469-63158491 ACTTGGGACACCAGCAAAGAAGG - Intronic
931572566 2:63684270-63684292 ACTTGGGCCTACAGCAAAAAGGG - Intronic
932008506 2:67952165-67952187 ACTTGTTCCTACAGCTTAAAAGG - Intergenic
933254775 2:80068565-80068587 ACTTGGGCTTTCAGCATCAAAGG - Intronic
937092510 2:119215903-119215925 ACATGGGCCTGGAGCAGAAAAGG + Intergenic
940861459 2:158774312-158774334 CCTTGGGCCTACAGAATAAAGGG + Intergenic
941773141 2:169364124-169364146 ACTTAGGCTTAAAGAAAAAAAGG + Intergenic
943777550 2:191782809-191782831 ACGTGAGCCTTCAGAAAAAAAGG + Intergenic
945955362 2:216081683-216081705 ACTTGGCCCTGCAGCAAACCAGG + Exonic
1170828816 20:19821567-19821589 ACTTGAGCCTCCAGCAATAGTGG + Intergenic
1172234994 20:33365975-33365997 ACTTGGGGCTAGAGAATAAATGG - Intronic
1172413549 20:34744677-34744699 ACTCGGGCCTAAAATAAAAAAGG - Intronic
1173922624 20:46757698-46757720 CCTAGGGCCGACAGCCAAAACGG - Intergenic
1177319109 21:19497099-19497121 ACTTTGGCCCACAGTACAAATGG - Intergenic
1177840041 21:26225499-26225521 CTTTGAGCCTACAGCACAAATGG + Intergenic
1184048273 22:41985969-41985991 ACTCTGGCCTACAGCAAAGCAGG - Exonic
1184353010 22:43957238-43957260 ACTCGGGCCCACAGAAACAATGG + Intronic
1184658967 22:45956619-45956641 ACATGGGTCTATAGCACAAATGG + Intronic
952026803 3:29092617-29092639 CCTTGGGCCTAGAGCTGAAATGG + Intergenic
952344493 3:32471128-32471150 AAGTGGCCCTACAGCAAAATTGG + Intronic
952635909 3:35530581-35530603 ACTTGGATCTACATAAAAAAAGG + Intergenic
957598650 3:82302792-82302814 AATTGGGCATAAAGCAAAACAGG - Intergenic
958213347 3:90522887-90522909 ACTTGGAAATACAACAAAAAGGG + Intergenic
960373691 3:116872114-116872136 ATTTGGGCCTACAACAATTAAGG - Intronic
963935912 3:151053111-151053133 ACTTGATCGTACAGTAAAAATGG - Intergenic
965378366 3:167955801-167955823 ATTTGGCCATATAGCAAAAAAGG + Intergenic
965459290 3:168941815-168941837 ACTTGGAACTACATCAATAAAGG + Intergenic
968922678 4:3530821-3530843 ACTTGGGCCAGCACCCAAAAGGG + Intronic
969751126 4:9112091-9112113 AGATGGGCCACCAGCAAAAAGGG - Intergenic
970756448 4:19432575-19432597 ACTTGGGTCTACAGAAAGAAGGG + Intergenic
970805883 4:20031766-20031788 AATTGTGCCTCCAGAAAAAATGG + Intergenic
972024453 4:34360178-34360200 ACTTGAGACTACTGCAAAAACGG - Intergenic
974986103 4:69027342-69027364 ACTTGCACAAACAGCAAAAATGG + Intronic
977056087 4:92192615-92192637 ATGTGAGCATACAGCAAAAAAGG - Intergenic
977579950 4:98714109-98714131 GCTGGGGGCTACAGCAGAAAGGG - Intergenic
978936790 4:114387603-114387625 ACTTGGGCTAACAGGAAGAATGG - Intergenic
980379442 4:131992827-131992849 ATTTGAGCATACAGAAAAAAAGG + Intergenic
982817480 4:159904634-159904656 ACTTTGGCCACCAGCAAAATGGG + Intergenic
984335457 4:178383717-178383739 ACTTGGGAATACAGCTAACAAGG + Intergenic
985355429 4:189114459-189114481 ACTTGGTCCTGAAGCAAAAATGG + Intergenic
987725758 5:21697028-21697050 ACTTGGGAATACAGCTAACAAGG - Intergenic
988082024 5:26426826-26426848 AATTGGGCCCACAGCAAGAAAGG - Intergenic
989834485 5:45969202-45969224 ACTGATGCCTACAGTAAAAATGG + Intergenic
991571578 5:68059967-68059989 ACTTGGATCTACACAAAAAAAGG - Intergenic
995327712 5:110910137-110910159 GCTTGTGCCTACAGGAAAATTGG - Intergenic
995376955 5:111484511-111484533 ACTTTGTCCTTCAGCAAGAAAGG + Exonic
996148621 5:120007501-120007523 AATTGGGCATACAGTATAAAGGG + Intergenic
997414105 5:133711836-133711858 CCTTGGGCTTAGAGGAAAAATGG + Intergenic
999106466 5:149075409-149075431 ACTTGGGCCTAGAGCCGATAGGG - Intergenic
999405541 5:151303672-151303694 ACTTTGCCCTACAGCAGCAAGGG - Intronic
1000196659 5:158965961-158965983 ACCTTGGCTTAGAGCAAAAAAGG + Intronic
1005247569 6:23905932-23905954 ACTGGGGCCTGTAGGAAAAAGGG - Intergenic
1007447740 6:41920269-41920291 TCTTGGGTCTAGAGGAAAAAAGG - Intronic
1009841819 6:69087098-69087120 ACTTGAGCCTACACTAAAATTGG + Intronic
1012861647 6:104567672-104567694 ACTAGGCCCTACAGCAACCATGG + Intergenic
1023117474 7:36876396-36876418 ACTTGGGCCAAAAAAAAAAAAGG - Intronic
1025519446 7:61704045-61704067 TTTTGTGCCTACAGTAAAAAAGG + Intergenic
1025543770 7:62132697-62132719 TTTTGTGCCTACAGTAAAAAAGG + Intergenic
1025578750 7:62682973-62682995 ATTGAGGCCTACGGCAAAAAAGG + Intergenic
1025585112 7:62774616-62774638 ATTTTGGCCTACAGTGAAAAAGG - Intergenic
1025592086 7:62873970-62873992 ATTTGGGCCTACAGTGAGAAAGG + Intergenic
1026646680 7:72176857-72176879 TCTTGGGCCAACAGAAAGAAGGG - Intronic
1030253282 7:107475064-107475086 ACTTGGGCCTAAACATAAAATGG - Exonic
1032960578 7:137029018-137029040 GCTTGGGGACACAGCAAAAAGGG + Intergenic
1033636548 7:143217507-143217529 ACTTGGGGCAACAGGAAAAGTGG - Intergenic
1040805629 8:51393454-51393476 ACTTGGCAATACAGCAATAAAGG - Intronic
1041049994 8:53925054-53925076 ACTTGGACCTACAGCCAAGCAGG + Intronic
1055303994 9:74910066-74910088 ACTTCTCCCTAAAGCAAAAAGGG + Intergenic
1056428148 9:86499514-86499536 ACTTGGACCTACATAAAGAAAGG - Intergenic
1058469290 9:105260738-105260760 AGCTGGGCCAACAGCAAGAAGGG + Intronic
1059538074 9:115102221-115102243 GCTTGGCCCTCCAGCACAAAAGG - Intronic
1187310738 X:18138954-18138976 ACTTGGACCCACATAAAAAAAGG + Intergenic
1192943728 X:75941592-75941614 ACTTAGGAATACAGCAAATAAGG - Intergenic
1194606370 X:95983971-95983993 TCTCTGGGCTACAGCAAAAATGG - Intergenic
1198412996 X:136390663-136390685 ACTTGAGCCTACAGTGCAAAGGG + Intronic
1198718452 X:139588642-139588664 TCCTGGGATTACAGCAAAAATGG - Intronic
1199307220 X:146280319-146280341 AGTTGGCCAAACAGCAAAAATGG + Intergenic