ID: 931573800

View in Genome Browser
Species Human (GRCh38)
Location 2:63698529-63698551
Sequence CTGTTGGCACAGACTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931573795_931573800 -4 Left 931573795 2:63698510-63698532 CCTCTAGAATCTAATCCCTCTGT 0: 1
1: 0
2: 0
3: 8
4: 139
Right 931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG 0: 1
1: 0
2: 1
3: 36
4: 259
931573794_931573800 3 Left 931573794 2:63698503-63698525 CCTGGAGCCTCTAGAATCTAATC 0: 1
1: 0
2: 0
3: 15
4: 176
Right 931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG 0: 1
1: 0
2: 1
3: 36
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931573800 Original CRISPR CTGTTGGCACAGACTGAGGC TGG Intronic
900092703 1:927371-927393 CTGTCGGAAGAGACTGACGCTGG - Intronic
900457264 1:2783372-2783394 CTATCCACACAGACTGAGGCTGG + Intronic
901974440 1:12932983-12933005 CTGTTGGCAGAGCCTGGGACAGG - Intronic
902010732 1:13268784-13268806 CTGTTGGCAGAGCCTGGGACAGG + Intergenic
902105495 1:14032496-14032518 GTGTTGGGACAGACAGAGGTTGG - Intergenic
902754324 1:18539263-18539285 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
903420070 1:23212484-23212506 GTGTTGGCACAGAGAGAGGCTGG - Intergenic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
904203236 1:28835456-28835478 GTTTTGGCACAGCCTGAGGAAGG - Intronic
907340406 1:53731353-53731375 CTGTTGGCTGAGACTGAGAAAGG + Intronic
907980330 1:59474063-59474085 CAGTTGGAACAGAGTGATGCAGG - Intronic
908845687 1:68322065-68322087 ATGGTGGCACATGCTGAGGCTGG + Intergenic
908947660 1:69519244-69519266 CATGTGGCACAGACTGCGGCAGG + Intergenic
910436327 1:87209548-87209570 CTGTTAGAACTGACTCAGGCAGG + Intergenic
911609287 1:99943366-99943388 GTGTTGGCAGAAGCTGAGGCAGG + Intergenic
912688624 1:111786758-111786780 CTTTTGGAACTGACTGGGGCTGG + Intronic
916619895 1:166485960-166485982 CAGTTGGCTCAGGGTGAGGCTGG - Intergenic
918044759 1:180935217-180935239 CGGTGGGCACAGGCCGAGGCGGG + Exonic
920028963 1:203024590-203024612 CTGTTCACACAGAGTGAGCCTGG + Exonic
920029343 1:203027129-203027151 TCTCTGGCACAGACTGAGGCTGG - Intronic
921893986 1:220380016-220380038 CTGTGGGCACAGCCTGGGGGTGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
924543789 1:245006421-245006443 CTGTAATCACAGGCTGAGGCAGG - Intronic
1063987266 10:11518224-11518246 CTGATTTCACAGACTGAGGTGGG + Intronic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1064378180 10:14816003-14816025 CTATTGGGGGAGACTGAGGCAGG - Intergenic
1065291906 10:24238913-24238935 CTGTTGGCAGAAACTTAGCCGGG - Intronic
1069250010 10:66256067-66256089 ATGTTGGCCCAGACAGAGGCAGG + Intronic
1069888524 10:71638772-71638794 CTGCTGGGACAGACTCAGGTCGG + Intronic
1069997184 10:72349594-72349616 CTGGTGGCCCAGGCTGAGCCTGG + Intronic
1070806853 10:79275721-79275743 CTGGTGGTAGAGCCTGAGGCTGG - Intronic
1071501283 10:86206046-86206068 ATGCTGGCACAGATGGAGGCTGG - Intronic
1073490904 10:103852710-103852732 CTGGTGGGACAGACAGGGGCAGG - Intronic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1074889706 10:117725305-117725327 CTGTGGGCTAAGAATGAGGCTGG - Intergenic
1075608994 10:123836424-123836446 CTGGTGGCACAAACTGTGTCAGG - Intronic
1077024313 11:432545-432567 CTGTAGGCACAGGGGGAGGCTGG - Intronic
1077098675 11:811209-811231 CTGTAGTCCCAGACTGAGGTGGG + Intronic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1078517568 11:12036698-12036720 GTTTTGGCACAGAATGATGCTGG - Intergenic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1081688228 11:45057498-45057520 CTGCTGGCACAATCAGAGGCTGG + Intergenic
1084459010 11:69285934-69285956 CTGCTAGGCCAGACTGAGGCAGG - Intergenic
1085352640 11:75809671-75809693 CTGACGGCATAGAATGAGGCTGG - Intergenic
1085447654 11:76611249-76611271 GTGCTGGCCCAGCCTGAGGCTGG + Intergenic
1085460013 11:76687920-76687942 CTGAAGGGACAGACTGGGGCAGG + Intergenic
1085538371 11:77241819-77241841 CTGTAGTCTCAGCCTGAGGCAGG + Intronic
1087659540 11:100970737-100970759 CTCTTGGCACTGGCTGAGGGAGG + Intronic
1088431858 11:109767914-109767936 CTGTTGGAACATACAGAGGCAGG + Intergenic
1089320376 11:117622405-117622427 TTGATGGCACAGAGTTAGGCTGG + Intronic
1090407080 11:126482794-126482816 CAGTTGGCACAGAATGTGGGGGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091646744 12:2277969-2277991 CTCTTAGCACAGACTGAGGCTGG + Intronic
1092898365 12:13035594-13035616 CTGTAGCCCCAGGCTGAGGCAGG - Intergenic
1093669011 12:21850173-21850195 TTGTTGTCACAAACTGGGGCAGG - Intronic
1095280904 12:40352049-40352071 TTGTGGGCAGAGACTGAGGCTGG - Intronic
1095908586 12:47403141-47403163 CACTGGGCCCAGACTGAGGCTGG - Intergenic
1096692697 12:53330832-53330854 CTCTTGGCAGAGACTCCGGCTGG + Intronic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1098022560 12:66170826-66170848 CAGGTGGCAAAGAATGAGGCTGG + Intergenic
1099545998 12:83980372-83980394 ATGCTGGCTCAGACTGAGGGTGG + Intergenic
1102304859 12:111797069-111797091 ATGGTGGCACATGCTGAGGCAGG - Intronic
1102950075 12:117025586-117025608 GTGTTGGCAAACACTGTGGCCGG + Intronic
1102953687 12:117046261-117046283 CTGTGAGCACTGACTGAGGCCGG + Intronic
1108756117 13:53504435-53504457 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
1112562130 13:100524247-100524269 CTCTTCCCACAGACTGGGGCAGG + Intronic
1113784006 13:112992979-112993001 CGTTTGGCAGAGACTGAGCCGGG - Intronic
1113878341 13:113608363-113608385 CGGTTGCCACAGGCTGGGGCTGG + Intronic
1114513323 14:23280300-23280322 CTGTTGGAAGAGACAAAGGCTGG - Intronic
1115342977 14:32311844-32311866 CTGTTGGCAAATACTGAGCTTGG + Intergenic
1116616560 14:47148050-47148072 CTGTTGTTACATAGTGAGGCAGG - Intronic
1117060535 14:51958134-51958156 CCGTTGGCACAGACTGAAAGTGG + Intronic
1117630579 14:57686561-57686583 CTTTTGGCACAGACTGCAGGCGG + Intronic
1118821468 14:69348935-69348957 CTGCTTGCACCGACTGAGGCAGG - Intronic
1120497661 14:85256673-85256695 CTGTGGTCCCAGGCTGAGGCAGG - Intergenic
1121665361 14:95667722-95667744 CTCTGGCCACAGAGTGAGGCAGG - Intergenic
1121762098 14:96454588-96454610 TTGGTGGCCCAGGCTGAGGCAGG - Intronic
1122605386 14:102944606-102944628 CTGTGTGCACAGCCTGAGCCCGG + Intronic
1124497003 15:30192859-30192881 CCTCTGGGACAGACTGAGGCAGG - Intergenic
1124746573 15:32345788-32345810 CCTCTGGGACAGACTGAGGCAGG + Intergenic
1125875111 15:43137534-43137556 CTGCTGGCACAGACTTAGCTAGG - Intronic
1128242262 15:66109064-66109086 CTGCTGGCACTCACTGAGGGTGG + Intronic
1129002863 15:72348314-72348336 CTGTTGACACAGGCTGAGAAAGG + Intronic
1129077693 15:73011285-73011307 CTGTTGGCAAACCCTGAGTCTGG + Intergenic
1129240938 15:74251762-74251784 CCCTGGTCACAGACTGAGGCTGG + Intronic
1129521033 15:76186401-76186423 CTGTTGGCCCAGTCACAGGCTGG - Intronic
1129906979 15:79195399-79195421 CTGTGGGCACATGCTGAGGAGGG - Intergenic
1131070034 15:89460506-89460528 CTTATGGGACAGGCTGAGGCTGG - Intergenic
1131507142 15:93029068-93029090 CTGTTGGCGCTGACTGAGGAGGG - Intergenic
1132724212 16:1331944-1331966 CTGTTGGAACAAACACAGGCCGG - Intergenic
1133187877 16:4113656-4113678 CTGTCTGCAGACACTGAGGCTGG + Intronic
1133215011 16:4286866-4286888 GTGGTGGCAGAGGCTGAGGCGGG - Intergenic
1133238690 16:4402365-4402387 CTGTGGTCCCAGGCTGAGGCAGG - Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1134454097 16:14381352-14381374 GTGTTGTCCCAGACTGAGGGAGG + Intergenic
1134847872 16:17456097-17456119 CTGTGTGCACAGAGTGAAGCTGG - Intronic
1135544343 16:23355652-23355674 CTGGAGGCAGAGCCTGAGGCAGG + Intronic
1136021107 16:27440628-27440650 CTGTGGGCACAGACTGAACCTGG + Intronic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1141220353 16:82063787-82063809 CTGCTGGCTCAGGCTGAGGGTGG + Intronic
1141851454 16:86649123-86649145 CTGTTGGCCCAGATTAAGCCTGG + Intergenic
1142713875 17:1737674-1737696 CTCCTGGCATAGACTGAGGCAGG + Exonic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1143065575 17:4244613-4244635 GTGTTGGCATGGAATGAGGCAGG - Intronic
1143577664 17:7804080-7804102 CTGTTGGCAATGACCCAGGCAGG + Intronic
1144526059 17:15990963-15990985 CAGGTGGCACACACCGAGGCAGG - Intronic
1146666611 17:34709263-34709285 CTGTTGCCACACACTGGTGCTGG - Intergenic
1147554408 17:41467243-41467265 CCGCTGGAACAGACCGAGGCAGG + Exonic
1147997111 17:44366259-44366281 CTGTTGGCCCAGGGTGAGGTAGG + Intergenic
1148978482 17:51550182-51550204 CTGTTGTCACACACTGGGGCTGG + Intergenic
1149165668 17:53749252-53749274 CTGTGAGATCAGACTGAGGCTGG - Intergenic
1150157686 17:62868017-62868039 CTGGTTGCACAGCCTCAGGCAGG + Intergenic
1151198934 17:72453520-72453542 TTGTTGGAACAGACTGCTGCGGG - Intergenic
1151709071 17:75790183-75790205 GTGGTGGCACACACTGAGGCAGG + Intronic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1151867497 17:76813900-76813922 CTGTAGCCACAGGCTGAGGTGGG - Intergenic
1151868146 17:76818633-76818655 CTGATGGCAAACACTGAGGATGG - Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1154532533 18:15362200-15362222 CTGTTCACAGAGCCTGAGGCAGG + Intergenic
1155074378 18:22342002-22342024 CTGGAGGCATAGGCTGAGGCTGG + Intergenic
1157557148 18:48620298-48620320 GGGATGCCACAGACTGAGGCAGG - Intronic
1158007206 18:52686323-52686345 CTGTTGGAACAGAGGTAGGCTGG - Intronic
1158547059 18:58405544-58405566 CTCATGGGACAGGCTGAGGCGGG + Intergenic
1158605868 18:58895569-58895591 CTGTTGGAGCTGGCTGAGGCTGG + Intronic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1159421161 18:68221476-68221498 ATGTTGCCCCAGACTGAGCCAGG + Intergenic
1161266093 19:3365513-3365535 CTGGGGGCTCAGACGGAGGCAGG + Intronic
1161962586 19:7530698-7530720 CTGTTGGCAAAGACTGACTCAGG - Intronic
1162421793 19:10569605-10569627 CTGCTGGCTCAGTCTGAGCCCGG - Intergenic
1163250684 19:16124818-16124840 CTGTGGACCCAGGCTGAGGCGGG + Intronic
1163456138 19:17406682-17406704 CTGTGGTCCCAGGCTGAGGCTGG + Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1165003838 19:32788232-32788254 CTGTAATCCCAGACTGAGGCAGG - Intronic
1165535427 19:36440296-36440318 CACTTGGCAGAGACTGAGGTAGG + Intergenic
1166165330 19:40983958-40983980 GTGTGGGCACTGACTGAGGTAGG - Intergenic
1166369199 19:42292030-42292052 CTGTGGCCCCAGACTGGGGCAGG - Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
1167109804 19:47453376-47453398 CTGCCTGCTCAGACTGAGGCAGG + Intronic
1167498375 19:49831945-49831967 GTGTTGGCATCCACTGAGGCAGG - Exonic
1167566752 19:50261664-50261686 CTGTTGGCCGAGACTGGGTCAGG + Intronic
1168401696 19:56089012-56089034 CTGGGGGCGCAGACTGGGGCGGG + Exonic
925295070 2:2770894-2770916 CTGTAGTCTCAGGCTGAGGCAGG - Intergenic
926705425 2:15834210-15834232 CTGTGGGCAAGGACTGAGCCTGG + Intergenic
927200226 2:20573554-20573576 CTGTTGGCCCAGCCCGAGCCAGG - Intronic
927558226 2:24050366-24050388 CTGTGGGGACAGACCCAGGCTGG + Intronic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
929703373 2:44184694-44184716 CTGTTGGCACAGACTAAATCAGG + Intronic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
933168606 2:79100141-79100163 CTATCAGCACAGACTGGGGCAGG + Intergenic
934557374 2:95294586-95294608 CTGTGGGGAGAAACTGAGGCTGG - Intergenic
935331110 2:101978727-101978749 CTGTGGGCACTGGCTGTGGCGGG + Intergenic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
937888559 2:126917047-126917069 CCGTAGGAACAGGCTGAGGCTGG + Intergenic
938695900 2:133835318-133835340 CTGTAGGATCAGGCTGAGGCTGG - Intergenic
938710651 2:133973672-133973694 CTGTTGGGAGACACTGAGGAAGG - Intergenic
938950350 2:136249395-136249417 CTGTGGGCACAGGGAGAGGCAGG + Intergenic
939403784 2:141730180-141730202 ATGGTGGCTGAGACTGAGGCTGG - Intronic
944168678 2:196750809-196750831 CTGGTGGCCCAGACTGAGCCAGG - Intronic
944865715 2:203859490-203859512 GTGTTTGCACAGTCTGTGGCAGG - Intergenic
946206600 2:218113415-218113437 TTGTTGGCACAGGCAGTGGCAGG + Intergenic
946392723 2:219426222-219426244 CTGTTGGCAGTGAGTGAGCCTGG + Exonic
947589119 2:231374944-231374966 CTGATAGCACAGCCTGGGGCTGG + Intergenic
948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG + Intergenic
948487658 2:238291099-238291121 CTGTTGGCACTGTGGGAGGCAGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169075826 20:2759332-2759354 ATGGTGGCACAGACAGATGCAGG + Exonic
1169513953 20:6296408-6296430 GTGTTGGCAGGGAGTGAGGCTGG - Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1171146469 20:22788186-22788208 CTGCTGGGAGAGACTGAGGCTGG - Intergenic
1171247697 20:23625912-23625934 CTGGGGGCACAGAATGAGGCTGG - Intergenic
1172479320 20:35261627-35261649 CTGTTGGCTAAGATTGAGGCAGG - Intronic
1172501637 20:35432176-35432198 CTGAGGGGACAGACTGAGCCTGG - Intergenic
1172946020 20:38690174-38690196 TTCTTGGCACATCCTGAGGCTGG - Intergenic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1174737455 20:52978232-52978254 GTGGGGGCACAGACTGAGCCTGG + Intronic
1178021175 21:28410160-28410182 CTGTTGCAACAGACTGATGTTGG + Intergenic
1180929599 22:19579903-19579925 CTGTGGACACAGACTGAAACAGG - Intergenic
1181419501 22:22788257-22788279 CATATGGCACAGACTGAGGCTGG + Intronic
1181426672 22:22848453-22848475 CATGTGGCACAGACGGAGGCTGG + Intronic
1181729111 22:24831734-24831756 CTGTTGGCAAAGCCATAGGCAGG - Intronic
1182414078 22:30209883-30209905 CTGATGGAAAAGACTGAGGATGG + Intergenic
1184249904 22:43254028-43254050 CTGTTGGCTGGGGCTGAGGCTGG + Intronic
1184453908 22:44598467-44598489 TTGTTGACACGGACTGGGGCCGG - Intergenic
1185161557 22:49232929-49232951 CTGGGGGCACAGGCTGGGGCAGG + Intergenic
1185398777 22:50605474-50605496 GTGATGGCAGGGACTGAGGCTGG - Intronic
950655300 3:14432748-14432770 CTGTTTCCACAGCCAGAGGCAGG - Intronic
952067873 3:29593693-29593715 CTGTAGGCTCAAACTGAAGCAGG + Intronic
953607422 3:44420841-44420863 CTTTTGAGACAGCCTGAGGCTGG - Intergenic
953613841 3:44471972-44471994 CTGCTGGCACGCACCGAGGCTGG - Intronic
953931863 3:47009564-47009586 CTTTTTGCACAGTCTGGGGCGGG + Exonic
955513646 3:59706009-59706031 CTGTTGACACAGGCTTACGCTGG + Intergenic
955666036 3:61350053-61350075 CTATGGGCACGGATTGAGGCAGG + Intergenic
958124408 3:89336936-89336958 CTGTTGACCCAGGCTGAGGTGGG + Intronic
959129810 3:102340459-102340481 ATGCTGGCCCAGACTGAGGCTGG + Intronic
961034923 3:123635491-123635513 CAGGTGGCACTGACTCAGGCTGG - Intronic
961367131 3:126407095-126407117 CTGTGAACACAGCCTGAGGCGGG - Intronic
961522300 3:127473758-127473780 CAGTTGGCAGAGCCTGAGCCAGG + Intergenic
962026570 3:131554086-131554108 CTGTTGGGCCAACCTGAGGCTGG + Intronic
966150279 3:176860476-176860498 CTGTTGGCAAATACTGAGCCTGG + Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
968726110 4:2248533-2248555 CTGGGGGGACAGACTCAGGCAGG + Exonic
969242450 4:5909007-5909029 GTGTGGGGACAGCCTGAGGCAGG - Intronic
969298164 4:6281584-6281606 GTGGTGGCACAGCCTGAGGTAGG + Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
970831416 4:20344539-20344561 CTGTTGTGACTGACTGAGGCAGG + Intronic
972157702 4:36185069-36185091 GTTGTGGCACAGACTGTGGCCGG - Intronic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
973700196 4:53529580-53529602 CTGTTGGCAGGGACAGATGCAGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
977016699 4:91700288-91700310 TTGTTGGCACAGGCAAAGGCAGG - Intergenic
977022905 4:91777661-91777683 CAGGTGTCACTGACTGAGGCTGG + Intergenic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
985200418 4:187478911-187478933 CTGTTGGCACACAGTGAAGCCGG - Intergenic
985747863 5:1657321-1657343 CTGCTGGCACTGCCAGAGGCTGG - Intergenic
990307012 5:54503713-54503735 TTGTTGGCACAGGCAGTGGCAGG - Intergenic
991996676 5:72394555-72394577 CTGGTGGCACAGGATGGGGCTGG + Intergenic
995750814 5:115451707-115451729 CTCTGGGCACAGACTCAGGTGGG + Intergenic
996726368 5:126676173-126676195 CGGTGGGCAGAAACTGAGGCAGG - Intergenic
997617185 5:135255569-135255591 CTCTTGCTACAGACTTAGGCAGG - Intronic
997774509 5:136588869-136588891 CTGTTGGAACAGAGTGGGGCAGG + Intergenic
998211507 5:140202546-140202568 TTGTTGGCACCTACTGAGGCTGG + Intronic
999311369 5:150554064-150554086 CTGTGGTAAAAGACTGAGGCAGG + Exonic
999601633 5:153272568-153272590 CTTTTTGCACTGACTGAGGCCGG + Intergenic
1000288277 5:159846657-159846679 CAGTTGGCTCAGGCTCAGGCAGG - Intergenic
1000599924 5:163260117-163260139 ATGGTGGCACGCACTGAGGCAGG + Intergenic
1001192400 5:169643258-169643280 ATGGTGGCAGAAACTGAGGCTGG + Intronic
1001651544 5:173319505-173319527 CTGGTGGCCCAGACTTAGGGAGG - Intronic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1003881892 6:10486625-10486647 CTGCTAGCAGAGGCTGAGGCAGG + Intergenic
1004703591 6:18102040-18102062 CTGCTGGCACACTCTGAAGCTGG - Intergenic
1005364270 6:25061494-25061516 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
1006267965 6:32941130-32941152 CTGTTGTCTAAGACTAAGGCAGG - Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1007230903 6:40347216-40347238 CTGTTGGCCCAGCATAAGGCAGG - Intergenic
1013402536 6:109812868-109812890 CTGATGGCAGAGACAGATGCTGG + Intronic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1018138178 6:160799066-160799088 GTGTAGGCAAAGCCTGAGGCCGG - Intergenic
1018784292 6:167096073-167096095 CTGGTGGCACAGACTGGAACTGG - Intergenic
1019992331 7:4701049-4701071 CTGCTGGAACAGGCTGGGGCAGG - Intronic
1020695138 7:11404555-11404577 CTGCTGCCACAGCCTTAGGCTGG + Intronic
1022251539 7:28613305-28613327 CTGATGGCACTTGCTGAGGCAGG + Intronic
1022398094 7:30008851-30008873 CTGTAGCCCCAGGCTGAGGCAGG + Intergenic
1022454388 7:30545790-30545812 GTGTTGGGAGAAACTGAGGCAGG + Intronic
1022846171 7:34212233-34212255 CTGTAGCCACAGAATGAGGCAGG - Intergenic
1026519198 7:71101869-71101891 GTGTGGGCACACACTGAGCCAGG - Intergenic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1027751195 7:82149076-82149098 CTGAGTACACAGACTGAGGCAGG - Intronic
1029193640 7:98789154-98789176 CTGTTGGCTCAGACCCTGGCTGG + Intergenic
1029272400 7:99385075-99385097 CTGTAGTCCCAGCCTGAGGCAGG - Intronic
1030884253 7:114919531-114919553 GTGGTGGCTCACACTGAGGCAGG - Intergenic
1030924686 7:115437550-115437572 CTGTAGTCCCAGCCTGAGGCAGG - Intergenic
1032192717 7:129773761-129773783 CAGATGGCAGAGACTGAGGCTGG - Intergenic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1034176406 7:149103538-149103560 CTGTTGGCTCAAGTTGAGGCAGG - Exonic
1034290402 7:149926576-149926598 ATGTTGTCACAGCCTGATGCTGG + Intergenic
1034372599 7:150613010-150613032 GTGTTGGGAAAAACTGAGGCAGG - Intergenic
1034660669 7:152766265-152766287 GTGTTGTCACAGCCTGATGCTGG - Intronic
1035458237 7:159023428-159023450 CTGTGGGCACAGCCGGGGGCGGG - Intergenic
1036719428 8:11159458-11159480 CTGTTAGCAGAAAGTGAGGCGGG - Intronic
1038129786 8:24717301-24717323 GTGTTGGCAGAAGCTGAGGCAGG + Intergenic
1038609350 8:29045545-29045567 AGGATGGCACAGACTGAGCCGGG - Intronic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039007850 8:33060510-33060532 CTGTGGGATCAGGCTGAGGCTGG + Intergenic
1042683891 8:71416339-71416361 CTGTTTACACAGACATAGGCAGG - Intronic
1044716169 8:95101873-95101895 CTGATGGCACTGGCTGAGCCTGG - Intronic
1044831377 8:96253331-96253353 CTGTTGTCATGGAGTGAGGCAGG + Intronic
1044924132 8:97195449-97195471 CTCTGGACACAGAGTGAGGCTGG + Intergenic
1049748670 8:144273581-144273603 CGGTTGGGAGAAACTGAGGCCGG - Intronic
1050200519 9:3140548-3140570 CTGTTAGCATAGTCTGAGGTGGG - Intergenic
1050367798 9:4888565-4888587 CTGTTGCCTCTGACTGGGGCAGG - Intergenic
1050594148 9:7189027-7189049 CTGTTAGCTTAGACTGTGGCAGG + Intergenic
1052609190 9:30748492-30748514 ATGTTGGCACAGACTTATTCAGG + Intergenic
1055739940 9:79376910-79376932 CTGTGGTCCCAGGCTGAGGCAGG + Intergenic
1056888824 9:90470244-90470266 CTGCTGGGACAGACTGAAGTGGG + Intergenic
1057285978 9:93754640-93754662 TTGTTGGCACAGGCAGTGGCAGG - Intergenic
1059282336 9:113145632-113145654 CTCTGGTCACAGTCTGAGGCTGG - Intergenic
1060209284 9:121700047-121700069 CTGGGGGCACAGCCTGAGGCTGG + Intronic
1060762869 9:126270939-126270961 CTGGTGGCCCATGCTGAGGCAGG + Intergenic
1060931513 9:127492188-127492210 CTGATGGCACAGGCTGGGCCTGG - Intronic
1062320026 9:135986320-135986342 CTGCTGGCACTGGCTGTGGCAGG - Intergenic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1189208573 X:39263417-39263439 CTGTGGGATCAGGCTGAGGCTGG - Intergenic
1194100129 X:89693764-89693786 CCTTGGGCACAGACTGTGGCAGG + Intergenic
1194360146 X:92940391-92940413 CTGTGGGATCAGACTGAGGCTGG + Intergenic
1196189514 X:112780136-112780158 CTGTTGACACAGATTGAGTGTGG + Intronic
1196741869 X:119032187-119032209 CCCTTGGCACAGCCTGATGCTGG + Intergenic
1197828203 X:130613264-130613286 CTGGTGCCACAGAATGAGCCAGG - Intergenic
1198102562 X:133434809-133434831 CTGTAGCCTGAGACTGAGGCAGG - Intergenic
1198230406 X:134683810-134683832 ATGTTGGCACAAAGTGAGGTTGG - Intronic
1198800065 X:140439461-140439483 CTCTCGGCTCAGACTCAGGCCGG + Intergenic
1200223730 X:154405103-154405125 CAGTTGGCACTGAGTCAGGCTGG - Intronic
1200453129 Y:3355123-3355145 CCTTGGGCACAGACTGTGGCAGG + Intergenic
1200668349 Y:6056213-6056235 CTGTGGGATCAGACTGAGGCTGG + Intergenic