ID: 931575709

View in Genome Browser
Species Human (GRCh38)
Location 2:63716367-63716389
Sequence CGCAAAACTTAGCTGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931575709_931575715 28 Left 931575709 2:63716367-63716389 CCCTACCCCAGCTAAGTTTTGCG 0: 1
1: 0
2: 0
3: 15
4: 145
Right 931575715 2:63716418-63716440 AATCTATTTGATCATCTCTGTGG 0: 1
1: 0
2: 3
3: 14
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931575709 Original CRISPR CGCAAAACTTAGCTGGGGTA GGG (reversed) Intronic
901336202 1:8451274-8451296 TACAAAAATTAGCTGGGGTGTGG + Intronic
906794900 1:48689059-48689081 TACAAAACTTAGCTGGGCTGTGG + Intronic
906993381 1:50763100-50763122 CAAAAAAATTAGCTGGGGCATGG + Intronic
907154088 1:52316327-52316349 CACAAAAATTAGCTGGGCTTTGG + Intronic
907983233 1:59505501-59505523 GGCAAAACTGAGCTGGGGGCTGG + Intronic
910361251 1:86415373-86415395 CTCACAACTCAGTTGGGGTATGG + Intergenic
916039988 1:160953553-160953575 TACAAAAATTAGCTGGGGTGTGG + Intronic
1063681103 10:8188672-8188694 TACAAAAGTTAGCTGGGGTGTGG + Intergenic
1068504985 10:57889178-57889200 TGCAAAACTTATTTGGGGTATGG + Intergenic
1068639565 10:59388079-59388101 AGAAAAACTTGGCTGGAGTAAGG + Intergenic
1069507844 10:69017580-69017602 TACAAAAATTAGCTGGGGCATGG + Intergenic
1073088302 10:100910398-100910420 GACAAAACTTAGCTGGGATTTGG - Intergenic
1073131757 10:101193650-101193672 GGCAAAAATTTGCTGGGGAATGG + Intergenic
1079818995 11:25100988-25101010 TGTAAAACATAGGTGGGGTATGG + Intergenic
1080948173 11:36998391-36998413 TACAAAAATTAGCCGGGGTAGGG - Intergenic
1081914546 11:46722430-46722452 TACAAAAATTAGCTGGGGTGTGG + Intronic
1083589316 11:63883738-63883760 CACAAAAATTAGCCGGGGTGTGG - Intronic
1083872010 11:65494349-65494371 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1085608480 11:77924242-77924264 AACAAAAATTAGTTGGGGTATGG + Intronic
1087763246 11:102124105-102124127 TACAAAAATTAGCTGGGGCATGG - Intronic
1088923252 11:114277067-114277089 CACAAAAATTAGCTGGCGTTGGG + Intronic
1090951439 11:131476889-131476911 AGGAAAACTTATCCGGGGTATGG - Intronic
1096852200 12:54447643-54447665 TACAAAAATTAGCTGGGGTATGG - Intergenic
1099121255 12:78691717-78691739 TACAAAAATTAGCTGGGGTTTGG + Intergenic
1100546794 12:95611160-95611182 TGCAAAAATTAGCTGGGGCATGG - Intergenic
1103524445 12:121558607-121558629 TACAAAAATTAGCTGGGGCATGG - Intronic
1107833710 13:44396961-44396983 CCCAGAACTTTGCTGGGGAAGGG + Intronic
1109452329 13:62533328-62533350 CGCTAAACTCAGCTGGTGAAAGG - Intergenic
1115984954 14:39095450-39095472 TACAAAACTTAGCTGGGGTGTGG - Intronic
1119344122 14:73907735-73907757 TACAAAAATTAGCTGGGGCATGG + Intronic
1119521219 14:75286874-75286896 TGCAAAAATTAGCTGGGGGTGGG + Intergenic
1119753916 14:77100394-77100416 CACAAAAATTAGCTGGGCTTGGG - Intronic
1121059155 14:90887804-90887826 AAAAAAAATTAGCTGGGGTATGG + Intronic
1121756279 14:96405336-96405358 AAAAAAAATTAGCTGGGGTATGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125867642 15:43068342-43068364 TACAAAAATTAGCTGGGGTGTGG - Intronic
1126107812 15:45158358-45158380 AGGAAGACTTAGCTGGGGGAAGG + Intronic
1129865900 15:78908409-78908431 CAAAAAAATTAGCTGGGTTATGG - Intergenic
1131322846 15:91412193-91412215 CTCAAAACTAATCTGGGGAATGG + Intergenic
1136863769 16:33723271-33723293 CGCATAAATCAGCGGGGGTAGGG - Intergenic
1137740749 16:50770603-50770625 CACAAAAATTAGCTGGGCTCGGG - Intronic
1138486432 16:57347814-57347836 CAAAAAAATTAGCTGGGGCATGG + Intergenic
1138545508 16:57717000-57717022 TGCAAAAATTAGCTGGGCTGTGG + Intronic
1140462848 16:75154951-75154973 TACAAAAATTAGCTGGGCTATGG - Intronic
1141992397 16:87618006-87618028 TACAAAAATTAGCTGGGGCATGG + Intronic
1142622983 17:1176689-1176711 TACAAAACTTAGCTGGGTTGTGG + Intronic
1143127182 17:4650211-4650233 TGCAAAAATTAGCCGGGGCATGG - Intergenic
1143147167 17:4784207-4784229 TACAAAAATTAGCAGGGGTATGG - Intergenic
1144532128 17:16049739-16049761 TACAAAAATTAGCCGGGGTATGG - Intronic
1146065896 17:29635056-29635078 TACAAAAATTAGCTGGGGTGTGG - Intronic
1146116718 17:30147282-30147304 TACAAAAATTAGCTGGGGCATGG - Intronic
1147854556 17:43469228-43469250 CACCGAACTTAGATGGGGTATGG - Intergenic
1150017523 17:61573285-61573307 TACAAAAATTAGCTGGGGGATGG - Intergenic
1151359449 17:73579820-73579842 CACAAAAATTAGCTGGGGGTTGG + Intronic
1151544419 17:74783881-74783903 TGCAAAAATTAGCTGGGGGGTGG - Intronic
1152098753 17:78288550-78288572 TTAAAAACTTAGCTGGGGCATGG - Intergenic
1153976079 18:10269502-10269524 AGTATAACTTAGCTGGGGCAGGG + Intergenic
1156715237 18:40000688-40000710 AGCAAAACTTCTCTGGAGTAAGG - Intergenic
1157889240 18:51399150-51399172 CGCAAAGCCTAGCAGGGGTGAGG + Intergenic
1161327265 19:3669933-3669955 TGGAAAACTTTGCTGGGGTCAGG + Intronic
1162399170 19:10434358-10434380 CAAAAAAATTAGCTGGGCTATGG - Intronic
1163762001 19:19142330-19142352 GACAAACCTTAGCTGGGGTCTGG + Intergenic
1164309664 19:24034644-24034666 CGCAAAAATTAGCTGGGCGTCGG - Intronic
1166308032 19:41946308-41946330 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1166757805 19:45204343-45204365 CAAAAAAATTAGCTGGGGCATGG - Intronic
926058466 2:9790447-9790469 CACAAAAATTAGCTGGGGTGTGG - Intergenic
927709189 2:25314540-25314562 AGGAAAACGTAGCTGGGCTAGGG - Intronic
928193419 2:29194666-29194688 CACAAAAATTAGCGGGGGTGGGG - Intronic
928517254 2:32055205-32055227 TACAAAAATTAGCTGGGATATGG + Intergenic
930594499 2:53369876-53369898 AGCACTACTTAGCTGGGTTAAGG + Intergenic
931336058 2:61345116-61345138 TACAAAAATTAGCTGGGGCATGG + Intronic
931575709 2:63716367-63716389 CGCAAAACTTAGCTGGGGTAGGG - Intronic
931790054 2:65656992-65657014 TACAAAACTTAGCTGGGCTGTGG + Intergenic
934477033 2:94600580-94600602 TGAAAAAATTAGCTGGGATAGGG + Intronic
939674582 2:145056168-145056190 CACAAAAATTAGCTGGGCTTGGG + Intergenic
946218750 2:218207901-218207923 CAAAAAAATTAGCTGGGGTGTGG + Intergenic
947495697 2:230634821-230634843 TACAAAAATTAGCTGGGGGATGG + Intergenic
1172110720 20:32543322-32543344 TGCAAAAATTAGCTGGGGCTGGG + Intronic
1172317916 20:33970747-33970769 CCCAGTACTTAGCTGGGGTCTGG - Intergenic
1172402677 20:34663319-34663341 AACAAAAATTAGCTGGGGCATGG + Intronic
1174838610 20:53880791-53880813 TACAAAAATTAGCTGGGGCATGG + Intergenic
1183445771 22:37853476-37853498 TACAAAAATTAGCTGGGGCATGG + Intronic
1184091653 22:42296078-42296100 CACAAAACTCAGATGGGCTAAGG - Intronic
950389726 3:12687066-12687088 TACAAAAATTAGCTGGGGCATGG + Intergenic
950814959 3:15691277-15691299 TACAAAAATTAGCTGGGGCATGG - Intronic
953913668 3:46905147-46905169 AGCAAGAGTTAGCTGGGGGAAGG + Intergenic
955330038 3:58039847-58039869 CGCAAAACTAAGCCAGGGCAGGG + Intronic
960911618 3:122654854-122654876 CAAAAAAATTAGCTGGGGCATGG + Intergenic
964009312 3:151871134-151871156 TGCAAAAATTAGCTGGGGCATGG - Intergenic
964148957 3:153500548-153500570 TACAAAATTTAGCTGGGGCATGG - Intronic
965267602 3:166565233-166565255 GGTAAAACATAGCTGGGATATGG - Intergenic
966705091 3:182904731-182904753 TACAAAAATTAGCTGGGGTGTGG + Intronic
969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG + Intergenic
970695515 4:18672302-18672324 CACAAAAATTAGCCCGGGTATGG - Intergenic
974374047 4:61054017-61054039 TACAAAAATTAGCCGGGGTATGG - Intergenic
975980388 4:80151626-80151648 GGCAAAACTAGGCTGGAGTAAGG + Intergenic
976209460 4:82652995-82653017 TACAAAAATTAGCTTGGGTATGG + Intronic
976296020 4:83473122-83473144 TACAAAAATTAGCTGGGGTGTGG + Intronic
977535044 4:98248020-98248042 CACAAAAGTTAGCCGGGGCATGG - Intergenic
980045251 4:127980667-127980689 CACAAAAATTCGCTGGGGTGGGG + Intronic
980682771 4:136186276-136186298 CTCAAAACTAAGATGGGGCAGGG + Intergenic
980905872 4:138948195-138948217 TACAAAAATTAGCTGGGCTATGG + Intergenic
982356646 4:154476957-154476979 AGTAAAAGTTAGCTGGGGAAGGG + Intronic
984371867 4:178877879-178877901 TACAAAAATTAGCTGGGGTGTGG - Intergenic
984528712 4:180889195-180889217 TAAAAAACTTAGCTGGGGGATGG + Intergenic
985919233 5:2956763-2956785 GGCAAGACTTTGCTGGGGAAAGG + Intergenic
986036082 5:3941319-3941341 TACAAAAATTAGCTGGGGTGTGG - Intergenic
988856116 5:35229677-35229699 CCCAAAAGTCAGCGGGGGTAGGG - Intronic
990165948 5:52993291-52993313 AGCAAAGCTTAGCTGAGGTTGGG - Intronic
991276391 5:64852625-64852647 TACAAAAATTAGCTGGGGCATGG - Intronic
995560389 5:113374834-113374856 TACAAAAATTAGCTGGGGCATGG + Intronic
997546213 5:134710385-134710407 TACAAAAATTAGCTGGGGTGTGG - Intronic
999115742 5:149161717-149161739 TGCCACACTTAGCTGGGGTTTGG + Intronic
1003996383 6:11545088-11545110 TGCAAAACTTGGCTGGTGTTAGG + Intronic
1004167190 6:13267081-13267103 TGCAAAATGTAGCTGGAGTAAGG - Exonic
1004449300 6:15730203-15730225 AGCAACATTTAGCTGGGGTTTGG + Intergenic
1006556759 6:34873527-34873549 GGCAAAACCTAGCTGGGATGAGG - Exonic
1008833883 6:55803129-55803151 TACAAAAATTAGCTGGGGTGGGG + Intronic
1011476932 6:87757465-87757487 TACAAAAATTAGCTGGGGCATGG - Intergenic
1021464866 7:20930882-20930904 AGCAAAACATATCTGGGGTTTGG + Intergenic
1023940133 7:44763980-44764002 TACAAAAATTAGCTGGGGCATGG + Intronic
1024173978 7:46819440-46819462 CACTACACTTAGCTGGGGTTGGG - Intergenic
1025841446 7:65153413-65153435 TACAAAAATTAGCTGGGGCATGG + Intergenic
1025881601 7:65542556-65542578 TACAAAAATTAGCTGGGGCATGG - Intergenic
1025891838 7:65660060-65660082 TACAAAAATTAGCTGGGGCATGG + Intergenic
1026588642 7:71678278-71678300 TACAAAAATTAGCTGGGGCAGGG - Intronic
1030234571 7:107244093-107244115 TACAAAGATTAGCTGGGGTAGGG + Intronic
1033169057 7:139067303-139067325 TACAAAAATTAGCTGGGGTGTGG - Intronic
1034761132 7:153672935-153672957 CAAAAAAATTAGCTGGGGCATGG - Intergenic
1035210930 7:157327529-157327551 TACAAAACTTAGCTGGGGCCGGG - Intergenic
1037874154 8:22530674-22530696 TACAAAAATTAGCTGGGGTGTGG + Intronic
1038969020 8:32609825-32609847 TACAAAAATTAGCTGGGGTGTGG - Intronic
1039548226 8:38424836-38424858 CTCAAAACAGAGCTGGGGAAAGG + Intronic
1041225227 8:55691001-55691023 CGCAAAACTGAAGTGAGGTAGGG - Intergenic
1044874495 8:96651203-96651225 GGCAAAACTCAGCTGGGAAATGG + Intronic
1047517921 8:125571012-125571034 CACAAAAATTAGCTGGGGGCGGG - Intergenic
1053681037 9:40485512-40485534 TGAAAAACTTAGCTGGGATAGGG - Intergenic
1053931025 9:43113826-43113848 TGAAAAACTTAGCTGGGATAGGG - Intergenic
1054282676 9:63139422-63139444 TGAAAAACTTAGCTGGGATAGGG + Intergenic
1054294122 9:63321027-63321049 TGAAAAACTTAGCTGGGATAGGG - Intergenic
1054392144 9:64625516-64625538 TGAAAAACTTAGCTGGGATAGGG - Intergenic
1054426791 9:65130727-65130749 TGAAAAACTTAGCTGGGATAGGG - Intergenic
1054503584 9:65890813-65890835 TGAAAAACTTAGCTGGGATAGGG + Intronic
1058022293 9:100102251-100102273 CACAAAAATTAGCTGGGCTGTGG - Intronic
1058682370 9:107451218-107451240 TACAAAAATTAGCTGGGGTGTGG + Intergenic
1060888639 9:127174103-127174125 TACAAAAATTAGCTGGGGTTGGG + Intronic
1061463258 9:130757404-130757426 TACAAAAATTAGCTGGGGCATGG + Intronic
1185726074 X:2422955-2422977 CACAAAAATTAGCTGGGCTTGGG - Intronic
1186789797 X:12985889-12985911 AGAAAAAATTAGCTGGGGTATGG - Intergenic
1190081521 X:47360123-47360145 TACAAAAATTAGCTGGGGTGTGG + Intergenic
1190125306 X:47699463-47699485 CTTATAACTTAGCTGTGGTAAGG - Intergenic
1191692058 X:63950584-63950606 CACAAAAATTAGCTGGGTTGTGG - Intergenic
1196685262 X:118505177-118505199 CACAAAACTTAGCCGGGCAATGG - Intronic
1196701920 X:118679081-118679103 TAAAAAAATTAGCTGGGGTATGG - Intronic
1198098540 X:133403849-133403871 CACAAAAATTAGCTGGGGTGTGG - Intronic
1198198733 X:134392950-134392972 CAAAAAAATTAGCTGGGGTGTGG - Intronic
1198465807 X:136903804-136903826 CGCAAAAATTAGCTGGGCATGGG - Intergenic
1198919661 X:141711205-141711227 TACAAAAATTAGCTGGGGCATGG + Intergenic
1199704138 X:150409472-150409494 TGCAATACTTATCTGGGGTGAGG - Intronic
1201255451 Y:12103712-12103734 TACAAAAATTAGCTGGGGTGTGG - Intergenic
1201664518 Y:16434437-16434459 TACAAAAGTTAGCTGGGGCATGG + Intergenic