ID: 931578058

View in Genome Browser
Species Human (GRCh38)
Location 2:63741102-63741124
Sequence CTGCCTTTAGGGAAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 2, 3: 46, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931578054_931578058 6 Left 931578054 2:63741073-63741095 CCAGGAAGTCAGATGTTTCTGGA 0: 1
1: 0
2: 3
3: 17
4: 210
Right 931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG 0: 1
1: 1
2: 2
3: 46
4: 308
931578052_931578058 20 Left 931578052 2:63741059-63741081 CCTTAATGGGATATCCAGGAAGT 0: 1
1: 0
2: 1
3: 12
4: 93
Right 931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG 0: 1
1: 1
2: 2
3: 46
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931578058 Original CRISPR CTGCCTTTAGGGAAGGAAGC TGG Intronic
900241943 1:1621373-1621395 CAGCCATCAGGGAAGGCAGCTGG - Intronic
900251789 1:1674759-1674781 CTGCCTTTGGGGACGGGAGGAGG - Intronic
900262197 1:1737615-1737637 CTGCCTTTGGGGACGGGAGGAGG - Intronic
900746204 1:4362326-4362348 CAGCCAACAGGGAAGGAAGCTGG - Intergenic
901671510 1:10858765-10858787 CTGGAATTAGTGAAGGAAGCAGG + Intergenic
901789774 1:11648043-11648065 CTGCCTTTAGTAAAGGATGGGGG + Intergenic
903099159 1:21013113-21013135 GGGCCCTCAGGGAAGGAAGCCGG + Intronic
903230427 1:21919027-21919049 CTGCCTTTGGGGAAAGATGGGGG - Intronic
903279716 1:22243679-22243701 CTGCCTGCAGGGAGGGACGCTGG + Intergenic
904435431 1:30491914-30491936 CTGGGTCTGGGGAAGGAAGCTGG - Intergenic
907987329 1:59544951-59544973 CAGCCATCAGGGAAGGAAGATGG - Intronic
908364039 1:63399227-63399249 CTGACTTTAAAGAAGCAAGCTGG - Intronic
911634406 1:100218097-100218119 CTGCTTTGAGGCAAGGAGGCCGG - Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913656597 1:120966336-120966358 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914007734 1:143747592-143747614 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914334884 1:146705011-146705033 CATCCTTTAGGGGAGGAAGTAGG + Intergenic
914646560 1:149658073-149658095 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914823785 1:151126148-151126170 TTGCTTTTAGGGAAGGGAGTGGG - Intergenic
915556165 1:156661952-156661974 CAGCCTGGAAGGAAGGAAGCTGG - Intergenic
916854544 1:168736516-168736538 CATCCTTTAGGGAAGCAAGGTGG + Intergenic
920874934 1:209826101-209826123 CTGCCTCTGGGGAGGGAAACTGG + Intergenic
921151742 1:212408324-212408346 CTGCCTGGAAGGAAGGAGGCTGG - Intronic
921478466 1:215636744-215636766 CTGCCTTCAGGCAAGGGAACAGG + Intronic
922272766 1:224049441-224049463 TTGCTTCTAGGGAAGGAAGCTGG + Intergenic
922584727 1:226725000-226725022 CAGCCTCTAGGGAAGGAGTCTGG - Intronic
923054697 1:230417271-230417293 CTTCCTTTAAGGAAGGAGGAGGG - Intronic
923098387 1:230793447-230793469 CAGCCTTTGGGTAAGGGAGCAGG - Intronic
923242250 1:232097318-232097340 CTGCCTCAAGGCAAGGGAGCTGG + Intergenic
924029912 1:239875917-239875939 CTACCTTTAAGGGGGGAAGCTGG - Intronic
1064160125 10:12938125-12938147 CAGCCTTTAGGGTTGGAAGGAGG + Intronic
1066135370 10:32440414-32440436 CTCCCTTTGGGGAAGAAGGCAGG + Intergenic
1066200264 10:33137496-33137518 CTGGCTTGAGGGAAGGAAGGGGG - Intergenic
1067097183 10:43309508-43309530 CTGGCTTTAGGAAAGGAGGTGGG - Intergenic
1067459056 10:46444108-46444130 CTGCCTCTATGTAAGAAAGCAGG - Intergenic
1067665497 10:48274542-48274564 CAGCCTTTAACGAAGGACGCAGG - Exonic
1067814141 10:49459285-49459307 CAGCCTTTGGGGAAGGAAGTGGG - Intronic
1068335906 10:55631490-55631512 CGGCCTCCTGGGAAGGAAGCAGG - Intergenic
1068519698 10:58064685-58064707 TTGCCTTTATGGTAGGAAGCAGG + Intergenic
1068547158 10:58360537-58360559 CTGCCTTGAGGGCAGGAAACAGG + Intronic
1068741158 10:60472972-60472994 CTGCCTGTGGGGAAGGACGGGGG - Intronic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069999330 10:72364615-72364637 CTGCATCCAGGCAAGGAAGCAGG - Intergenic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1072273701 10:93801955-93801977 CTGCCTTGAGGCAAGGAGGATGG + Intergenic
1073947234 10:108765324-108765346 CTCCTTATAGGGAAGGAACCTGG - Intergenic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1075444055 10:122501529-122501551 CTGCCAGCAGGGAAGGAAGTTGG - Intronic
1075817995 10:125280789-125280811 CCATCTTTGGGGAAGGAAGCAGG - Intergenic
1076057726 10:127389330-127389352 CTGCATTTAGGAAAGGCAGGAGG - Intronic
1076536570 10:131181634-131181656 CTGCCTGTGGCCAAGGAAGCAGG + Intronic
1078084207 11:8224159-8224181 CTGGCTTTAGGGGAAGAAGCTGG - Intergenic
1078101561 11:8333230-8333252 CTGCGTTTTGGGGAGGAGGCTGG + Intergenic
1078350671 11:10590546-10590568 CTGTCTTGAGGCAAGGAAGAAGG + Intronic
1079242162 11:18728822-18728844 CTGACTGAAGGGGAGGAAGCGGG + Exonic
1080212959 11:29808208-29808230 ATGCCTTCTGGGGAGGAAGCAGG - Intergenic
1081005743 11:37735898-37735920 CTGTCTTTAAGGAAGAAAGTAGG - Intergenic
1081858523 11:46318859-46318881 GGGCCTTGAGGGGAGGAAGCTGG + Intronic
1082080319 11:48007720-48007742 CTGCCTGGAGGGAAGACAGCAGG - Intronic
1082688670 11:56272817-56272839 CTGCCTTTCAGGCTGGAAGCTGG + Intergenic
1085152488 11:74263172-74263194 CTGCCTTAAGGGCAGTGAGCAGG + Intronic
1085171383 11:74452615-74452637 CTCCCTTGAGGCAAGGCAGCTGG - Intergenic
1085347826 11:75779616-75779638 CTACCTTTGGGGAAGGCAGAGGG - Intronic
1087779307 11:102286293-102286315 CTCACTTCAGGGAAGGAAGGTGG - Intergenic
1089326588 11:117661645-117661667 CTGGCCTTAGGGAGGGATGCAGG - Intronic
1089349981 11:117816700-117816722 CTGCGTCTAGTGAAGGAAGTGGG - Intronic
1089572070 11:119417612-119417634 CTACTTTTAGGGAAGGAGCCAGG + Exonic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1092141037 12:6183467-6183489 GTGCCTTTAGCGTGGGAAGCAGG + Intergenic
1092255672 12:6925780-6925802 CTGCCTTCAGGGAAGGAAGGAGG - Intronic
1092924993 12:13264429-13264451 TTGCCTATAGTGAAGGAGGCAGG + Intergenic
1094254243 12:28403148-28403170 CTGGCTTTATGGAATGAATCAGG + Intronic
1096218353 12:49810676-49810698 CTGACTTAATAGAAGGAAGCTGG - Intronic
1097089845 12:56496197-56496219 TTGCCTCCAGGGAGGGAAGCTGG - Intergenic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1097850422 12:64405064-64405086 CTTCCTTTAGGGGAGGGATCGGG + Intronic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1101406429 12:104433132-104433154 GTGTTTTTAGGGAAGGAAGGCGG - Intergenic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1101879580 12:108617127-108617149 CTGCCAGCAGGGAAGGAAGGAGG - Intergenic
1102395409 12:112581502-112581524 CTGCCTTTATGGAAATGAGCAGG + Intronic
1110254983 13:73423368-73423390 CTGGCTGTAGGGAAGGAATAAGG + Intergenic
1111936075 13:94558071-94558093 CTGCCTGTCGGGAAAGAATCAGG - Intergenic
1115234836 14:31199255-31199277 CTGCCTTAATGGAAGATAGCTGG - Intronic
1117353519 14:54902680-54902702 CTGCCGTTCGGGAAGGACCCCGG + Exonic
1117728212 14:58695048-58695070 CAGCCTCAAGGGAGGGAAGCTGG + Intergenic
1118755682 14:68842105-68842127 CTGCCTCTAGGGACTGGAGCAGG + Intergenic
1119288755 14:73477544-73477566 CAGTATTTAGGAAAGGAAGCTGG + Intergenic
1119687800 14:76646597-76646619 CTGCCTATAAGCCAGGAAGCAGG - Intergenic
1120228971 14:81822329-81822351 CTGACCTTGGGGAAGGAATCAGG - Intergenic
1121510775 14:94511684-94511706 CTGCCTCTTTGGAAGGAAGCAGG - Intronic
1121638939 14:95472590-95472612 CTGCCTTTCAGGAAGGAGGGAGG - Intronic
1122584484 14:102795772-102795794 CTGCCTCTAGGGAATGAGGCAGG - Intronic
1122985068 14:105208207-105208229 CACCCTTTGGGGATGGAAGCGGG - Intergenic
1125397407 15:39264343-39264365 CTGCATTTAGGGAAACAAACTGG + Intergenic
1125721077 15:41845469-41845491 CAGCCCTTTGGGAAGGAGGCAGG + Intronic
1125891603 15:43270816-43270838 CTTCCTGTCCGGAAGGAAGCAGG + Intergenic
1126103627 15:45134320-45134342 CAACCTCTGGGGAAGGAAGCCGG + Intronic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1128078509 15:64842652-64842674 CTAGCTGTAGGGAAGGAATCGGG + Intronic
1128140615 15:65297984-65298006 CTCCCTATAGGGAAGGTAGTTGG - Intronic
1129293799 15:74588384-74588406 GTGCCTTTAGGGAAAGAAGGCGG + Intronic
1130916274 15:88307498-88307520 CTTCCTTAAGGGAAGGCAGAGGG - Intergenic
1131341531 15:91606880-91606902 CAGCCTTTAGGAAAGGAACGTGG + Intergenic
1131859664 15:96639110-96639132 CTGCCCTAAGGGAAGGAAAATGG - Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1134062148 16:11205775-11205797 CTGGCTTTCTGGAAGGGAGCTGG + Intergenic
1134401386 16:13913563-13913585 CTGCCCTGAGGCAAGGGAGCTGG - Intergenic
1135045980 16:19156233-19156255 CTGGCTTTGGGGAAGCAAGTTGG - Intronic
1136775486 16:32869622-32869644 CAGCCTTGAGGGGAGGAAGGTGG + Intergenic
1136895130 16:33991890-33991912 CAGCCTTGAGGGGAGGAAGGTGG - Intergenic
1136920474 16:34266951-34266973 CTGTCTTTAGTCAAGGAAGCAGG + Intergenic
1137247335 16:46716702-46716724 CTTCCTTTAGGGTAGGGGGCAGG - Intronic
1137275183 16:46928813-46928835 CTGCCTCTAGGAATGGAAGAGGG - Intronic
1137300559 16:47144104-47144126 CTGCCGTTAGGGCTGGGAGCCGG + Intergenic
1137947066 16:52743680-52743702 CTGCCTTTAAGGAAGAAAGAGGG - Intergenic
1138482784 16:57315034-57315056 TTGCCTCTGGGGAAGGAAGCAGG - Intergenic
1138540293 16:57683782-57683804 CTGCCGGCAGGGATGGAAGCTGG + Intronic
1139321808 16:66120528-66120550 CTGCCTTTGGGGAAAGGAGTGGG - Intergenic
1139615251 16:68084941-68084963 CTGGCTCTAGGGAAGGCATCAGG - Intronic
1139839882 16:69869801-69869823 CTTACTTTAGAGAAGGTAGCTGG + Intronic
1139998739 16:71006225-71006247 CATCCTTTAGGGGAGGAAGTAGG - Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141729546 16:85812502-85812524 CTGCATTTCTGGAAGGAGGCGGG - Intergenic
1141952518 16:87348104-87348126 CTGCCTGAAGGGGAGGCAGCTGG - Intronic
1141968923 16:87466762-87466784 CTGCCTTTATGGAAGCAGGCAGG - Intronic
1142116684 16:88360447-88360469 CTGCCTTTGGGGGAGCATGCGGG - Intergenic
1203077904 16_KI270728v1_random:1131731-1131753 CAGCCTTGAGGGGAGGAAGGTGG + Intergenic
1143578966 17:7813058-7813080 CTGCCTCTAAAGAAGGAACCTGG + Intronic
1146438477 17:32873300-32873322 ATGACTTAAAGGAAGGAAGCAGG + Intronic
1147794731 17:43034312-43034334 CTGGCTGGAAGGAAGGAAGCAGG - Intergenic
1147820465 17:43238501-43238523 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147822577 17:43250393-43250415 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147825094 17:43265188-43265210 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147828214 17:43282708-43282730 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147829324 17:43288872-43288894 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1147830414 17:43295007-43295029 CAGCCTTTAGAGAAAGAAGCAGG + Intergenic
1148496791 17:48057749-48057771 CTGCCTGAAGGAAAGGAAGAAGG - Intronic
1148738083 17:49875969-49875991 CAGCCTCTAGGGGAGCAAGCAGG - Intergenic
1149995983 17:61406097-61406119 GGGGCTATAGGGAAGGAAGCAGG - Intronic
1150229737 17:63543557-63543579 CTGCCTTATGGGAAGCAAGAGGG - Exonic
1150989497 17:70239572-70239594 TTGTCTTTAGGGAAAGTAGCAGG - Intergenic
1151699376 17:75734837-75734859 GTGCCTCTGGGGAAGGAGGCAGG + Intronic
1153027966 18:688399-688421 CTGCCTTTAGAGAAAGAGCCTGG + Intronic
1153910970 18:9706714-9706736 CTGGCTTTTGGGAATCAAGCTGG + Intergenic
1153922206 18:9801877-9801899 CTGCCTGCAAGGAATGAAGCTGG - Intronic
1153939175 18:9962420-9962442 CTGCCTTTAGGGAAAAAAGGGGG + Intergenic
1153951421 18:10060847-10060869 CTGCCCTGAGGGAAGGAATCAGG + Intergenic
1155267047 18:24104349-24104371 GTGCATTTAAGGAAGGAAGGAGG - Intronic
1156461194 18:37322272-37322294 CTGCCTTTATGGAAATGAGCTGG + Intronic
1158971593 18:62673163-62673185 CTGCCTGGAGGAAAGGATGCAGG - Intergenic
1161333492 19:3699248-3699270 CTGGCTCTGGGGAAGGAACCGGG + Intronic
1161390068 19:4016122-4016144 CTGCCTGTCGGCAAGGAAGCCGG + Intronic
1161489108 19:4552187-4552209 CTGCCTTTGGGGAGAGGAGCAGG - Intronic
1161590506 19:5127212-5127234 CTGGCCTGAGGGAGGGAAGCGGG - Intronic
1162930265 19:13953988-13954010 CAGCCTTCAGGGAGGGAAGCAGG + Intronic
1164603356 19:29578403-29578425 CGGCCCTAAGTGAAGGAAGCCGG - Intergenic
1164856573 19:31529334-31529356 GTGCCCTGAGGGCAGGAAGCAGG - Intergenic
1165028289 19:32978034-32978056 CTGCATCTAGTGAGGGAAGCAGG + Exonic
1165100274 19:33434954-33434976 CGGCCTGGAGGGAAGGCAGCTGG + Intronic
1166523266 19:43495388-43495410 CTGACATTAGGGAAAGCAGCTGG - Intronic
1167262213 19:48465121-48465143 CTGCCTCTGGGGAAGCAAGTTGG + Exonic
1167289197 19:48615175-48615197 CTGGCTGTTGGGAAGGAGGCAGG + Intergenic
1168108504 19:54179108-54179130 GTGCCTGTAGGGTAGGAAGGTGG + Intronic
926019835 2:9485287-9485309 CTTCACTGAGGGAAGGAAGCTGG + Intronic
926142150 2:10374064-10374086 CTGCCTGTGGGGAAGCAGGCGGG - Intronic
926613954 2:14976199-14976221 CAGCCTTTAGTGCAGGAAGATGG + Intergenic
927084391 2:19660093-19660115 ATCCCTTCAGGGAAGGAAGATGG + Intergenic
927305359 2:21565424-21565446 CTGTCTTTGGAAAAGGAAGCAGG - Intergenic
927890019 2:26742414-26742436 CTGCCTTCAGGGCAGGGAGCAGG + Intergenic
931343677 2:61426637-61426659 CTGCCCTGAAGGAAGGATGCAGG + Intronic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
935692379 2:105743768-105743790 CTTCCCTTCTGGAAGGAAGCAGG + Intergenic
936528700 2:113259897-113259919 CTGCGTTTGGGGAGGGAAACAGG + Intronic
937090232 2:119201367-119201389 CTGACTTGAGGCAAGGGAGCTGG + Intergenic
937176453 2:119940936-119940958 CTGGCTTTAAGGAAGGGAGCTGG - Intronic
937917224 2:127105293-127105315 GGCCCTTTAGGGAAGGAAGCAGG + Intronic
938107555 2:128543722-128543744 CTGCCCTAAGGTAAGGGAGCTGG + Intergenic
938369713 2:130761599-130761621 CTGCCTTCAGCCCAGGAAGCAGG + Intronic
941182320 2:162274484-162274506 CTGCATCTAGGGAGGGGAGCTGG + Intronic
943086508 2:183318329-183318351 CTGCCTTCAAGGCAGGAAGTTGG - Intergenic
943607933 2:189997893-189997915 GGGCCTTTGGGGAAGGCAGCTGG - Intronic
944618338 2:201485125-201485147 GTGCCATGAGGGAAGGAAGTAGG - Intergenic
945282305 2:208047404-208047426 CTGTCTAAAGGGAAGCAAGCAGG + Intergenic
947205911 2:227661040-227661062 CTTCCTTTATGGAAGAAACCTGG - Intergenic
947871179 2:233439454-233439476 CTGCCTTTGCGGAAGCAGGCTGG - Intronic
948041647 2:234905999-234906021 CTGCTGCTAGGGAGGGAAGCAGG - Intergenic
948347696 2:237312971-237312993 CTGCCTTTCGGGATGGACACAGG - Intergenic
1168866737 20:1092994-1093016 CTGCTGTTAGGGCAGGAAGGTGG + Intergenic
1169468641 20:5863717-5863739 CTTCCTTGAGGCAAGGGAGCTGG - Exonic
1169620919 20:7505869-7505891 CTGTCTCCAGGGAATGAAGCTGG - Intergenic
1169854150 20:10085220-10085242 CTGCCTTCAAGGCAGGAAGAAGG - Intergenic
1170345978 20:15387575-15387597 CTTCCTTTATGGAAGGAAGTGGG - Intronic
1170548876 20:17458394-17458416 CTACCTCCAGGCAAGGAAGCAGG + Intronic
1170734833 20:19005716-19005738 CTGCCTGAAGGAAAGGCAGCTGG - Intergenic
1171344651 20:24456847-24456869 TTGCCTTGAAGCAAGGAAGCTGG + Intergenic
1173172719 20:40740742-40740764 CTGGCCTTGGGGACGGAAGCTGG - Intergenic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1175891435 20:62317766-62317788 TTGCCTTCAGCAAAGGAAGCAGG - Exonic
1177816729 21:25986161-25986183 CTTCCTTTTGGGAAGGGAGTGGG + Intronic
1183785856 22:40028735-40028757 CTGCCTGTAGGGAGGGAAGGGGG - Intronic
1184769282 22:46588338-46588360 CTGCCTGGAGGGATGGAAGACGG - Intronic
1184833742 22:47008052-47008074 ATGCCATGAGGGAAGGAAGAGGG + Intronic
1185285769 22:49999455-49999477 CTGGCTGTAGGGCAGGAAGACGG + Exonic
949260704 3:2099635-2099657 CTGCTCTTAGGGAAGGTACCTGG + Intronic
949701112 3:6759971-6759993 TAGCCTATAGGGAAGGAAACAGG + Intergenic
950973016 3:17208577-17208599 CTAACTTTGGGGAAGGAAGTAGG - Intronic
952040733 3:29258323-29258345 CTGCCTTTAGGCAAAGTAGTTGG + Intergenic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
953227015 3:41030267-41030289 CCAGCTTTAGGGAAGGGAGCTGG + Intergenic
953775263 3:45811266-45811288 CTGGCTTTAGGAAGGGAAGTGGG - Intergenic
954393442 3:50279499-50279521 CAGCTCTTAAGGAAGGAAGCTGG + Intronic
954539455 3:51384319-51384341 CTGCCTTCAAGGCAGGATGCGGG - Intergenic
954641876 3:52105470-52105492 CTGCCCCTGGGGAGGGAAGCAGG + Intronic
955407311 3:58633585-58633607 CAGGCTTCAGGGAAGGCAGCCGG - Intergenic
955925129 3:63996853-63996875 GAGGCTTTAAGGAAGGAAGCAGG + Intronic
959908245 3:111733916-111733938 CTCCCTTTAGGGAAGGAGTTGGG + Intronic
960087867 3:113609903-113609925 TTGCCTTTAGGGGAGGAAGGAGG - Intronic
961028635 3:123583790-123583812 CTGCCTCGAGGGAGGGGAGCTGG + Intronic
961187049 3:124924679-124924701 TTGCCTCTGGGGAAGGAAACTGG + Intronic
961415564 3:126754134-126754156 CTGCCTTGAGAGAAGGTAGCAGG + Intronic
961465249 3:127077346-127077368 CTGCCTTTAGGCCAGGAGGGAGG - Intergenic
961637881 3:128344471-128344493 CTGCCTTTGGGGAGGGGACCTGG - Intronic
961825400 3:129596611-129596633 GTCCCTTCAGGGGAGGAAGCTGG - Intronic
962732816 3:138299200-138299222 CTGGCTTTAGGGAAGGCTGAGGG + Intronic
962838837 3:139215237-139215259 CAGACTTGATGGAAGGAAGCTGG + Intronic
963858110 3:150277392-150277414 CTGACCCTGGGGAAGGAAGCAGG - Intergenic
964302255 3:155301710-155301732 CTTCCCTTATGGAAGGAATCAGG - Intergenic
965909586 3:173755573-173755595 CTGCCTTTGGAGACAGAAGCAGG + Intronic
967080928 3:186048764-186048786 CTGCCTTCAGGAACGGACGCTGG + Exonic
968253687 3:197246531-197246553 CTGCCTTAACTGAAGAAAGCAGG - Intronic
969248391 4:5951322-5951344 CTGCATTGAGGGAATGAAGGGGG + Intronic
969613839 4:8241162-8241184 CTGCCCCCAGGGAAGGGAGCTGG - Intronic
970318689 4:14854515-14854537 CTGGCTCTAGGGTAGGAGGCAGG - Intergenic
971307709 4:25498130-25498152 CTTCCTTTGGGGCTGGAAGCAGG + Intergenic
972639903 4:40915916-40915938 CTGCCTTGAGGGAGTGGAGCTGG + Intronic
973601800 4:52549568-52549590 CTTCCTTACTGGAAGGAAGCGGG + Intergenic
974456360 4:62133736-62133758 CTTCCTCCAGAGAAGGAAGCAGG - Intergenic
974578669 4:63765030-63765052 TTCCCTTTAGAGAGGGAAGCTGG + Intergenic
976209251 4:82651036-82651058 CTGGCTTTATGAAAGGCAGCTGG + Intronic
976392765 4:84522986-84523008 ATGACTATAGGGAAAGAAGCAGG + Intergenic
978116566 4:105025723-105025745 AGCCCTTAAGGGAAGGAAGCAGG + Intergenic
978760498 4:112352086-112352108 CTGCTTTTAGGGTTGGAACCAGG - Intronic
980120771 4:128725554-128725576 CTGCCTGTAGGGAAGCCAGCAGG - Intergenic
980421535 4:132566581-132566603 CTGCCTGTCAGGGAGGAAGCCGG - Intergenic
981483630 4:145262156-145262178 CTGACTTCAGGTAAGGAAGAAGG - Intergenic
983637429 4:169912205-169912227 CTGCCTCCAGGGAAGGAAACTGG - Intergenic
983884382 4:172963905-172963927 CTGCCTTTTAAGTAGGAAGCTGG - Intronic
983906515 4:173188632-173188654 CTGTCTTCAGGGGAGGAATCTGG + Intronic
985661424 5:1158968-1158990 CTGCCTTTGGGGCAGGAGTCCGG - Intergenic
986481286 5:8190784-8190806 CTGCCTTGGTGGAAGAAAGCAGG + Intergenic
987736279 5:21847525-21847547 CTGCCTTAGAGGAAGGAAGAAGG - Intronic
988500760 5:31781873-31781895 AGGCATTTAGGGAAGGCAGCTGG + Intronic
992454273 5:76901942-76901964 CTGCCTTGAAGGAAAGAACCCGG - Intronic
992556005 5:77904249-77904271 GGGGCTTTAGGGAAGGAAGGAGG - Intergenic
992752150 5:79871656-79871678 CTGCCTCTAGGGAGGGGAACTGG - Intergenic
993979448 5:94527189-94527211 CAGCCTTTTTGGAAGTAAGCTGG - Intronic
995331227 5:110949079-110949101 CTGTCTTTAGTCAAGGAAGCAGG + Intergenic
995543286 5:113205053-113205075 CTACTTTTGGTGAAGGAAGCAGG + Intronic
995619784 5:114011849-114011871 CTGCCTTTAAGGAAGGAACCCGG - Intergenic
997275391 5:132582934-132582956 CTGGATTTAAGGAATGAAGCAGG + Intronic
998046193 5:138989027-138989049 TTGCCTTGAGGCAGGGAAGCAGG + Intronic
999286881 5:150399438-150399460 TTTCCTTTTGGGAAGGAAGATGG + Intronic
999892914 5:155998800-155998822 CTGTCTTTAGGGAACCCAGCAGG - Intronic
1002279533 5:178122336-178122358 CTTCCTCCAGGGAAGGAGGCTGG + Exonic
1003496095 6:6664491-6664513 ATGACTTCAGGGAAGGAAGAGGG - Intergenic
1004109417 6:12700857-12700879 TTGACTCTAGAGAAGGAAGCCGG + Intergenic
1004570527 6:16840344-16840366 CTGACTTTGGGGAAAGGAGCAGG + Intergenic
1006248701 6:32762154-32762176 CTTCCTTTAGGGAGGTAAGAGGG + Intronic
1007319774 6:41019170-41019192 CTGCCTTTTGGGAAGGTAACAGG + Intergenic
1007590641 6:43018730-43018752 CTGCATTTAGGGCAGGAACAAGG + Intronic
1008506282 6:52233873-52233895 CTCCTTTTAGGGAAGGGAGTGGG + Intergenic
1009882524 6:69586218-69586240 CTGCAATTAGGGAAGGAAACTGG - Intergenic
1010261715 6:73824532-73824554 CTGCAGTTTGGGAAAGAAGCTGG + Exonic
1013452790 6:110301437-110301459 CTTGCTTTATGGAAGGAAGTGGG + Intronic
1014410877 6:121118764-121118786 CTGACTTTGGGAAAGGAAGCAGG - Intronic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1015723673 6:136275678-136275700 CTGTCTTTAGTCAAGGAAGCAGG + Exonic
1017353949 6:153480071-153480093 CTGACTTTAAGGAGGGAAACTGG - Intergenic
1017770691 6:157642321-157642343 ATTCCCTTAGGGCAGGAAGCTGG + Intronic
1017880822 6:158561064-158561086 CTGCCTTCAGTGCAGGGAGCCGG - Intronic
1018609750 6:165636614-165636636 TTGCATTTAGGGTGGGAAGCTGG - Intronic
1020966468 7:14876024-14876046 CTGCCTTTGAGGTAGGAGGCAGG + Intronic
1021194103 7:17655183-17655205 TTGCCTTTAGGCAAAGAACCTGG - Intergenic
1022010016 7:26300632-26300654 CTGCCTTCAGAGATGGAGGCTGG - Intronic
1022073915 7:26946881-26946903 CTGCCAGTATCGAAGGAAGCTGG + Intronic
1022095061 7:27134740-27134762 CTGCCTTCATGGAAGTAATCAGG - Intronic
1022707464 7:32817628-32817650 CTGCCTTTTGGGAAATGAGCAGG + Intergenic
1023162354 7:37309545-37309567 CTGCCTTTGGTGAAGGACTCTGG - Intronic
1023523978 7:41079489-41079511 GTGCCTTCAGGGAAGATAGCTGG + Intergenic
1023759512 7:43450865-43450887 CAGGCCTCAGGGAAGGAAGCTGG - Exonic
1024421893 7:49177626-49177648 AAGCCTTTGGGGAAGGAGGCAGG - Intergenic
1026674933 7:72420449-72420471 CTCCCCTTAAGGAGGGAAGCAGG + Intronic
1026848725 7:73711938-73711960 CAGCCTTCTGGGAAGGTAGCAGG - Intronic
1026982255 7:74533668-74533690 CTTCCCTTAGGGAGGGAAGCAGG - Intronic
1028786921 7:94805641-94805663 CTATCTTTAAGCAAGGAAGCAGG + Intergenic
1029216830 7:98956626-98956648 CTGCATTCAGGAGAGGAAGCTGG + Intronic
1031986910 7:128169158-128169180 TAGCCTTTGGGGAAGGAATCTGG - Intergenic
1032117665 7:129130292-129130314 CAGCCTCTGGGGAAGGAAACTGG - Intergenic
1032225584 7:130028919-130028941 CCGGCCTTAGGGAAGGAAGCTGG + Exonic
1032271177 7:130408087-130408109 CTTCCCTTGGGGAAGGAGGCAGG - Intronic
1032792765 7:135254491-135254513 CAGCCTTTAGGAAAGGTGGCAGG - Intronic
1033518475 7:142134197-142134219 CTACTTTTAGGAAAGGAAGGAGG - Intronic
1035564881 8:634945-634967 GTGCCTCTGGGGAAGGAAGGAGG + Intronic
1035765548 8:2102036-2102058 TGTGCTTTAGGGAAGGAAGCAGG - Intronic
1036124609 8:6051595-6051617 CTGCTTTTGGGAAGGGAAGCTGG - Intergenic
1036393926 8:8350535-8350557 TTGCCTATAGGCAAGGCAGCTGG - Intronic
1036823390 8:11957407-11957429 GTGCATTTAAGGAAGGAAGTTGG - Intergenic
1037106044 8:15110193-15110215 CTGTCTTTAGGGAGGGAGGTAGG + Intronic
1037650834 8:20837016-20837038 GTGACATTAGAGAAGGAAGCAGG - Intergenic
1037689971 8:21173294-21173316 CATCCTTTAGGGAAGAAACCAGG + Intergenic
1038239824 8:25798216-25798238 CAGCCTGTAGGCAAGGAAGATGG + Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1044428876 8:92085332-92085354 TTGCTGTTAGGGAAGAAAGCAGG - Intronic
1047187766 8:122649600-122649622 CTGCCTTGAGGTAAGGGGGCTGG - Intergenic
1047330571 8:123883312-123883334 CTGCCTCAAGAGAAGGAAGTGGG + Intronic
1047733188 8:127743417-127743439 CTGACTTTCGGGAAGGAAGTTGG - Intergenic
1048047780 8:130789761-130789783 CTGCTTTAAGGCAAGGTAGCAGG - Intronic
1048394566 8:134001892-134001914 CTGCCTTGAGGCAAGGGAGATGG - Intergenic
1048398938 8:134045097-134045119 CTGCCTTTATTGAAGGTAGGTGG + Intergenic
1049184310 8:141241399-141241421 CTGCCTTCGGGGAAGGGAGATGG + Intronic
1051237988 9:15022155-15022177 ATGCCTTTAGTGAAGGAACAAGG - Intergenic
1052869111 9:33486149-33486171 ATGCCTTCAGTGAAGCAAGCAGG - Intergenic
1053400893 9:37821013-37821035 TTGCCTTTGGGGAGGGAAACTGG - Intronic
1053586311 9:39462883-39462905 CTGCCTCTGGGGAAGCAATCAGG + Intergenic
1054579993 9:66902346-66902368 CTGCCTCTGGGGAAGCAATCAGG - Intronic
1055637310 9:78291733-78291755 CTGGCTTGAGGGGAGGGAGCTGG - Intergenic
1056605506 9:88081795-88081817 CTTCCTCTAGGGTTGGAAGCTGG - Intergenic
1057689288 9:97268916-97268938 ATGCCTTCAGCGAAGCAAGCAGG + Intergenic
1057782180 9:98058791-98058813 CAGCCTTTAGGAAAGGGATCTGG + Intronic
1057905398 9:98978847-98978869 TTGTCTCCAGGGAAGGAAGCTGG - Intronic
1057942843 9:99299940-99299962 CTGCCTGAAGGGGAGGATGCAGG - Intergenic
1058040431 9:100296016-100296038 CAGCCTTTGGGGAAGGAGGGAGG + Intronic
1061759960 9:132843768-132843790 TTGCCTCCAGGGAAGGAAGCTGG + Intronic
1062242194 9:135546657-135546679 CTGCCTTTAGGGGTGGCAGCCGG + Intronic
1062511829 9:136910507-136910529 ACACCTTTAGGAAAGGAAGCTGG + Intronic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1062585527 9:137247760-137247782 CTCCCCTCAGGGAAGGGAGCTGG - Exonic
1185523452 X:759132-759154 ATGCCTCTAAGGTAGGAAGCAGG + Intergenic
1185633425 X:1534581-1534603 CTGCCTCTAGGGACAGAAGAGGG + Intronic
1186398554 X:9235122-9235144 CAGCCTTCATGGAAGGAAGAAGG - Intergenic
1188243478 X:27815186-27815208 CAGCCTTCATGGAAGGAAGCAGG - Intronic
1188245933 X:27835741-27835763 CAGCCTTCGTGGAAGGAAGCAGG - Intergenic
1188321608 X:28745221-28745243 CAGCCTTTAGGGTAGGACCCAGG + Intronic
1189099344 X:38172776-38172798 CTGCCCCCAGGCAAGGAAGCTGG + Intronic
1189481660 X:41396661-41396683 CTGCCTTTGGGGAGGGACCCAGG - Intergenic
1189819176 X:44853624-44853646 CTGCCTTTGGGGAGGGGAACTGG - Intergenic
1191190317 X:57659470-57659492 CTGTCTTTGGGGTAGGAAGTTGG + Intergenic
1191640574 X:63427069-63427091 CAGCCTTTGGGAAATGAAGCGGG + Intergenic
1192797092 X:74432938-74432960 TGGCCTTTAGGGAGGGAAACAGG - Intronic
1193455389 X:81725286-81725308 CTCCCTGAAGGGAAGGAAACAGG + Intergenic
1194164100 X:90492372-90492394 TTGCCTTTATTGCAGGAAGCTGG - Intergenic
1196136657 X:112217136-112217158 CTGATTGGAGGGAAGGAAGCTGG + Intergenic
1196497129 X:116334980-116335002 CTGCCTTGAGGGATAGAAGTTGG - Intergenic
1196941533 X:120781315-120781337 TTGCCTCTAGGGATGGAAACTGG - Intergenic
1198051639 X:132957489-132957511 CTGCCGGGAAGGAAGGAAGCGGG - Intronic
1200228130 X:154430657-154430679 CGGCCTTTAGGGAAGGAAGCAGG + Intronic
1200510359 Y:4070176-4070198 TTGCCTTTATTGCAGGAAGCTGG - Intergenic