ID: 931582409

View in Genome Browser
Species Human (GRCh38)
Location 2:63791357-63791379
Sequence TTAGTATTCCAATTCTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931582405_931582409 -5 Left 931582405 2:63791339-63791361 CCAATCTCCGTTCCTTACTTAGT 0: 1
1: 0
2: 0
3: 12
4: 156
Right 931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG 0: 1
1: 0
2: 2
3: 16
4: 270
931582404_931582409 23 Left 931582404 2:63791311-63791333 CCATGTTGGCTCAGTTTCTATCA 0: 1
1: 0
2: 1
3: 20
4: 239
Right 931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG 0: 1
1: 0
2: 2
3: 16
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931582409 Original CRISPR TTAGTATTCCAATTCTTTAT GGG Intronic
901706214 1:11075325-11075347 TTAGTATTACATATCTTTATAGG + Intronic
905839030 1:41157986-41158008 GTAATATTCCTATTCTTTCTTGG + Intronic
906444524 1:45883652-45883674 TTAGTTTTAGAATTCTTAATGGG + Intronic
906694416 1:47814507-47814529 TTAGAATTCCAAATCTTTCCTGG + Intronic
906765044 1:48422055-48422077 TCATTATTCCAAATCTGTATTGG - Intronic
908876260 1:68681059-68681081 TTAGTATTTAAATTCTGTTTGGG + Intergenic
909723320 1:78803207-78803229 ATTGTATTCAAATTTTTTATAGG - Intergenic
910262969 1:85309185-85309207 TTAGAATTCCTTTTCTTTAGTGG - Intergenic
910728296 1:90361614-90361636 TTAGAATTCCTTTTCTTTCTTGG + Intergenic
911274550 1:95845198-95845220 TTAGTATTTCAGTCCTCTATAGG - Intergenic
911410909 1:97505060-97505082 TTAATTTTACCATTCTTTATCGG - Intronic
911939645 1:104025597-104025619 TAAGTATTCCTAATCTTTTTTGG - Intergenic
912168871 1:107073044-107073066 TTATTCTTCCTATTCTTTAGGGG - Intergenic
912929360 1:113942876-113942898 TTATTATTTCACTTCTTGATTGG - Intronic
913171533 1:116237053-116237075 TTTGTATTCAAATCCTTTGTCGG + Intergenic
915799028 1:158768899-158768921 TTCTTATTCCTATTGTTTATTGG + Intergenic
917332546 1:173896770-173896792 TTAGGATTCTATTACTTTATAGG - Exonic
919167514 1:193914550-193914572 TTAGTTTTCAAATGCTTAATTGG - Intergenic
919496440 1:198275998-198276020 TAAGTATCCAAATTCGTTATAGG - Intronic
920585500 1:207155594-207155616 TTATTATGCTAATTCTTGATGGG + Intergenic
920797405 1:209153573-209153595 TTAGGATTTCAATTCTGTCTTGG + Intergenic
921691262 1:218153303-218153325 TTTGTATTCCAATTTCTTTTCGG - Intergenic
924321567 1:242855766-242855788 TTATTATTTCAATACTTTTTGGG + Intergenic
924503714 1:244660928-244660950 CTATTATTCCAAAGCTTTATTGG + Intronic
1063295829 10:4805080-4805102 TTAATATTCAAAATCCTTATTGG + Intronic
1064798367 10:19039866-19039888 TCAATATTCAAATTATTTATGGG + Intergenic
1064893087 10:20202036-20202058 TTAGAGTTCGAATTATTTATTGG + Intronic
1065365518 10:24932498-24932520 TTCAAATTCCAATTATTTATGGG - Intronic
1069315137 10:67089445-67089467 TTAGCATTCCAATGGTTAATTGG - Intronic
1069316902 10:67115956-67115978 TCAGTATTCCTATGCTTCATAGG + Intronic
1072511663 10:96132174-96132196 TGAGTATTTCAGTTCTATATGGG + Intronic
1072880870 10:99227765-99227787 CTAGAATGCAAATTCTTTATAGG - Intronic
1074430667 10:113391471-113391493 TTAGTATTCCCATTCTACACAGG + Intergenic
1074486271 10:113884974-113884996 TTAGTATTTTTATTTTTTATTGG + Intronic
1075536999 10:123279608-123279630 TTAGTATCCAAATACTGTATGGG + Intergenic
1076472088 10:130726008-130726030 TAAGCATTCCATTTCTTTCTTGG - Intergenic
1080269732 11:30438378-30438400 TTCTTATTCCTATTCTTCATAGG - Intronic
1081207978 11:40296649-40296671 TACTTATTCCAATTCTTTTTGGG - Intronic
1081282947 11:41232645-41232667 TTTGTATTTCAATTATTTAATGG - Intronic
1083909644 11:65698760-65698782 TTATTCTTCCAAATCTTTTTGGG - Intergenic
1085553281 11:77395262-77395284 TTGCTATTACAATTGTTTATAGG + Intronic
1086947551 11:92858079-92858101 TTTTTATTCCAACTATTTATTGG - Intronic
1087053165 11:93906247-93906269 TCTGTATCCCAATTCATTATTGG + Intergenic
1087521426 11:99242253-99242275 TTAGTATTTCAATATTTGATTGG + Intronic
1087743601 11:101916910-101916932 TTAGTGTTGTATTTCTTTATAGG - Intronic
1088151027 11:106745531-106745553 TTAATATTCAAATACTTTCTTGG + Intronic
1088339444 11:108746368-108746390 TCAGTATTGCATTTCTTTTTAGG + Intronic
1088801286 11:113309394-113309416 ATAGTATTCCAAGTGTGTATGGG + Intergenic
1089250024 11:117152308-117152330 TTAGTTTCCCAATTGTTTCTAGG + Intronic
1090584560 11:128196957-128196979 TTAGGATTTGAATTCTTTATAGG + Intergenic
1091044235 11:132311729-132311751 CTATTATTCCAATTCTTTATTGG + Intronic
1091467135 12:694556-694578 TTAGTTTTCCATTTCTTAACTGG + Intergenic
1091895545 12:4100934-4100956 TTTGTGTACAAATTCTTTATCGG - Intergenic
1093017520 12:14170156-14170178 TCATTATTCCAATTCATTTTTGG + Intergenic
1093390589 12:18614974-18614996 TTATTATTTCAATGCTTTTTAGG + Intronic
1094324095 12:29217949-29217971 TCAGAATTCCATTTCTTTTTTGG - Intronic
1094344842 12:29456042-29456064 CTAGTATTCCAATTTTATTTTGG + Intronic
1095229560 12:39723027-39723049 TTGGTATTCAAAGTCTTTACTGG - Intronic
1095744883 12:45646865-45646887 TAAGTACTCCAATTGTTTCTAGG - Intergenic
1099196675 12:79625181-79625203 CTAGTTTTCCATTTCTCTATAGG + Intronic
1101457912 12:104856167-104856189 TTAGTTTTCACCTTCTTTATGGG - Intronic
1103306368 12:119967812-119967834 TTGGTATTTCATTTGTTTATTGG - Intergenic
1104835097 12:131784832-131784854 TTAGTAATAGAATTCTTTAAAGG - Intronic
1107811911 13:44208622-44208644 TTAGTTTTCTTATTCTTTTTAGG + Intergenic
1108807279 13:54174542-54174564 TGAGAATTTCAATTGTTTATAGG - Intergenic
1110378983 13:74827806-74827828 TTACTATTACAATTGTTTTTGGG + Intergenic
1110520272 13:76467885-76467907 TTAGTAAACCATTTCATTATTGG + Intergenic
1110703919 13:78582814-78582836 TTAATATTCCCTTTCCTTATTGG + Intergenic
1113132870 13:107057602-107057624 TTTGTATTGCAATTCTTAAGTGG - Intergenic
1116405848 14:44565275-44565297 TTATTACTCCATTTCTTTCTTGG - Intergenic
1116691376 14:48110813-48110835 TTTGTATTCTAATTCTTTCATGG + Intergenic
1118113060 14:62744568-62744590 TTAGTATCCCAAATCATAATAGG - Intronic
1118560282 14:67072012-67072034 TTAATATTTCCATTATTTATAGG + Intronic
1118665113 14:68060508-68060530 ATAGTATTTTAATTATTTATAGG + Intronic
1123693853 15:22862653-22862675 TTAGTTTTAGAATTCTTTGTGGG + Intronic
1125063842 15:35458131-35458153 TTTGTATTCTTATTTTTTATTGG + Intronic
1128197270 15:65770366-65770388 TTACAATTCCAATACTTTAAAGG - Intronic
1131745057 15:95438583-95438605 TTATTATTCCAATTTTATAGCGG - Intergenic
1133499231 16:6349793-6349815 ATGGTTTTCCAATACTTTATAGG + Intronic
1135388298 16:22065078-22065100 TTAGTATTTAATGTCTTTATGGG + Intronic
1135836793 16:25833229-25833251 TTAGGATTCCGTTTTTTTATGGG + Intronic
1138142818 16:54583098-54583120 CTAGAATTCCAATTCCTTCTTGG - Intergenic
1138326997 16:56182376-56182398 TGAGTATTCCAATTAATAATTGG - Intergenic
1138713946 16:59000224-59000246 TTAGCAGTCAAATTCTTGATGGG + Intergenic
1139031670 16:62890248-62890270 TTAATTTTCTAATTCATTATTGG + Intergenic
1140330255 16:74049527-74049549 TTATTATTTCAATTGTTTTTGGG + Intergenic
1140334255 16:74089455-74089477 TTAGCATTCTAATTTGTTATCGG - Intergenic
1140348807 16:74241789-74241811 TTAATTTTCCAACTCTGTATGGG - Intergenic
1141229374 16:82150470-82150492 TTAGTTTTCCTTTTCTTTTTTGG - Intronic
1141332542 16:83124988-83125010 TTATAAAACCAATTCTTTATTGG + Intronic
1143687603 17:8531162-8531184 TTTGTATTCAAATTATTTTTCGG - Intronic
1143931075 17:10425788-10425810 TCAGTTTTCGAATTTTTTATTGG + Intergenic
1144545067 17:16186999-16187021 TTAGTATTGGAATGCTTTTTAGG - Intronic
1149012649 17:51873362-51873384 ATGTTTTTCCAATTCTTTATAGG - Intronic
1151792975 17:76321215-76321237 TTACTATTCCAATTGTTTTGGGG + Intronic
1153427295 18:4979696-4979718 TTTGCCTTCCAATCCTTTATGGG + Intergenic
1155283693 18:24267246-24267268 TTAGTTTTCTATTTCTTTTTGGG - Intronic
1159680236 18:71341240-71341262 TTACTATGCTATTTCTTTATTGG - Intergenic
1159693262 18:71519172-71519194 TTACTATTACCATTCTTAATTGG - Intergenic
1164409332 19:27986159-27986181 TTAGTTTTGCAATTCTTTAAAGG - Intergenic
1165660302 19:37573141-37573163 TTTTTCTTCCAACTCTTTATTGG + Intronic
925338904 2:3119695-3119717 TTAGTAATAAAATTCTTTTTGGG + Intergenic
925527871 2:4823605-4823627 TTACTATTGCAATTGTTTTTGGG + Intergenic
925550981 2:5074135-5074157 TTAGTATTCCCCATCTTCATAGG - Intergenic
927397966 2:22676651-22676673 TTAGAATTCCAATATTTTCTTGG - Intergenic
929359081 2:41061948-41061970 TTATTATTCTCATTCTTTAAAGG - Intergenic
929368177 2:41187392-41187414 TTATTCTTTCAGTTCTTTATAGG - Intergenic
929863716 2:45700287-45700309 TTAGTTTTCCATTTCTTTGGGGG - Intronic
930457134 2:51619286-51619308 TTTGTCTGCCAATTCATTATCGG - Intergenic
931582409 2:63791357-63791379 TTAGTATTCCAATTCTTTATGGG + Intronic
934745798 2:96758877-96758899 TTATTTTTCCTTTTCTTTATTGG + Intergenic
935229746 2:101085223-101085245 TTACTCATCCAATCCTTTATTGG - Intronic
935870702 2:107446116-107446138 TTAGTGTTCCTATTATTTAATGG - Intergenic
936340409 2:111626419-111626441 TGAGAATTTCAATTTTTTATTGG - Intergenic
943867272 2:192941831-192941853 TTAATATTCAAAATTTTTATAGG + Intergenic
944879880 2:204001894-204001916 TTAATATACCACTTCTTTCTTGG - Intergenic
944979553 2:205100303-205100325 TTAGTTTTATAATTCTGTATGGG - Intronic
945099806 2:206253446-206253468 TTTGTCTTGGAATTCTTTATGGG + Intergenic
947522531 2:230858498-230858520 TTCGTTTTATAATTCTTTATTGG - Intergenic
1169812403 20:9621604-9621626 TTGGTATTCTCATTCTTTCTTGG - Intronic
1170533442 20:17316646-17316668 TTATTATTCTAACTTTTTATAGG - Intronic
1170704390 20:18732281-18732303 TTGGTATTCCAATGCATAATTGG - Intronic
1174523341 20:51151340-51151362 TTATTATTCCCATAATTTATTGG - Intergenic
1174687951 20:52473586-52473608 TCATCATTCCAATTCTTAATTGG + Intergenic
1175885012 20:62284973-62284995 TGAGTATTCCAAAGCTTTAAGGG - Intronic
1177115029 21:17074955-17074977 TTAGTTTTTCAATAGTTTATTGG + Intergenic
1177213896 21:18104606-18104628 TTAGTAGTCCAGTCCTATATTGG - Intronic
1177884862 21:26734897-26734919 TAAGGATTCCAGTTCTGTATGGG + Intergenic
1181693301 22:24578547-24578569 GCACTGTTCCAATTCTTTATGGG - Intronic
949547974 3:5088788-5088810 TTAGTGTACTAATACTTTATTGG + Intergenic
949664081 3:6316475-6316497 TGTGTAATTCAATTCTTTATAGG + Intergenic
950746556 3:15094886-15094908 GTTGTATTCAAAGTCTTTATTGG - Intronic
951337386 3:21441120-21441142 TTATTATTTCAAGTCTTTATGGG - Intronic
951392453 3:22123322-22123344 TTAGTTTTTAAAATCTTTATGGG + Intronic
951394061 3:22142879-22142901 TTACTATTGCTATTCTTTATGGG - Intronic
953038741 3:39236364-39236386 ATATTATTACAATTATTTATTGG - Intergenic
955804191 3:62717171-62717193 CTAGTAATCCAACTCTTTGTTGG - Intronic
956192269 3:66619456-66619478 TTAGTATTCCAATTTCTTGATGG + Intergenic
956319337 3:67978973-67978995 TTGGTATTCAAAACCTTTATTGG + Intergenic
956473218 3:69591319-69591341 TTATTTCTCCAATTCTTTGTAGG + Intergenic
957707467 3:83807552-83807574 TTATACTTTCAATTCTTTATTGG - Intergenic
957910969 3:86619778-86619800 TTGCTTTTCTAATTCTTTATAGG - Intergenic
958971952 3:100621024-100621046 TTACTATTGCAATTGTTTTTGGG + Intronic
959294385 3:104516968-104516990 TTAGTGTTCCAAAACTGTATGGG - Intergenic
959315132 3:104795141-104795163 ATAGTATGCCAATTATTCATGGG + Intergenic
959373264 3:105556529-105556551 TTATTATTCCAGTACTTTCTTGG + Intronic
960077695 3:113506265-113506287 TTAGGATTCCAATTCTTCAGAGG + Intronic
960757414 3:121031145-121031167 ATAATATTCAAATTCCTTATGGG - Intronic
965263480 3:166511997-166512019 CTAGTATTCCAATTAATCATAGG - Intergenic
965281191 3:166755020-166755042 TCAGTTTTGGAATTCTTTATTGG - Intergenic
965987307 3:174770881-174770903 TTTTTATTTCAATTGTTTATGGG + Intronic
966138866 3:176732247-176732269 TTAGTATTACTGTGCTTTATCGG - Intergenic
968241436 3:197090737-197090759 ATAATATTCCAATTCTTGAAAGG + Intronic
969857261 4:10010199-10010221 TCAGTGTTCCAAATTTTTATTGG - Intronic
970760121 4:19475653-19475675 CTAGTATTGCAATTTTTAATAGG + Intergenic
971632885 4:29017651-29017673 ATAGAATTGCAATTATTTATTGG + Intergenic
973027409 4:45290100-45290122 TTAGTATTTCAATTTTTTTCTGG + Intergenic
973144646 4:46810683-46810705 TGAGTGTTCCAATACTTTAATGG - Intronic
973609555 4:52622221-52622243 TTAATGTTCCATTTTTTTATAGG + Intronic
973812848 4:54589103-54589125 TTAGGATTCCAATTACTTCTGGG - Intergenic
974500308 4:62691231-62691253 TTAGTATTCAAATACTTTGTTGG + Intergenic
974570799 4:63646170-63646192 TTATTTTTCCACTTCTGTATTGG + Intergenic
975445842 4:74464151-74464173 CTATTATTCCAATCCTTTGTGGG + Intergenic
976040919 4:80884370-80884392 TTAATATTCCACTTATTTGTGGG - Intronic
977389890 4:96394126-96394148 TTATTATTCAGATTTTTTATTGG - Intergenic
977690328 4:99900221-99900243 TTAAAATTCCAATACTTTAAAGG - Exonic
979744100 4:124188269-124188291 TTAGTACTCTAATTCTCTCTGGG - Intergenic
980215510 4:129847870-129847892 TTTGTATTCCAACTCTTGAGTGG + Intergenic
980262586 4:130471497-130471519 TAAGTATTCCATTTCTATATCGG - Intergenic
980337308 4:131493688-131493710 TGATTATTCTAATGCTTTATGGG + Intergenic
980433412 4:132736143-132736165 TTATTATTCTATTTCTTCATTGG - Intergenic
980835387 4:138185688-138185710 TTAGTATTAGAAATGTTTATAGG - Intronic
981038623 4:140198246-140198268 TTAGCATTCAAATTCCTGATAGG - Intergenic
982146361 4:152398514-152398536 TTAGCATTACAATTATTTGTGGG - Intronic
982493277 4:156056953-156056975 TTAGTTTTCCAATTCTTTTTGGG + Intergenic
982824731 4:159988529-159988551 TTAGAACTCCAATCTTTTATTGG + Intergenic
983786251 4:171733235-171733257 TTATTATTCCAGAGCTTTATTGG - Intergenic
984399155 4:179239250-179239272 TTAATATTTCAATACTGTATTGG - Intergenic
986529772 5:8724204-8724226 TTAGAATTACATTTCTTTACAGG - Intergenic
987003395 5:13684464-13684486 TTAGTTTTCCAAGGCTCTATTGG - Intergenic
987511133 5:18840728-18840750 TTGGTATTCCAAATCATTTTTGG - Intergenic
987520249 5:18973078-18973100 TTAAAATTCCAGTTCTTCATTGG - Intergenic
988071359 5:26292433-26292455 TTAATATTGTAATTATTTATTGG - Intergenic
989774722 5:45190708-45190730 CTTGGATTCCAATTCTTTTTTGG + Intergenic
991622730 5:68562274-68562296 TTAGTTTTCTAGTTGTTTATGGG - Intergenic
993467112 5:88262563-88262585 TCAATAGTCCATTTCTTTATAGG - Intronic
993537462 5:89104521-89104543 TATGTAAGCCAATTCTTTATAGG - Intergenic
993741578 5:91547197-91547219 TTTGTTTTCCAATTCTTTGAAGG + Intergenic
993859957 5:93124228-93124250 CTTTTATTCTAATTCTTTATAGG + Intergenic
994798515 5:104338730-104338752 TTAATATAGCAATTATTTATTGG + Intergenic
994924970 5:106103793-106103815 TTAGTATTCCTATTTGTTTTAGG - Intergenic
995397865 5:111707261-111707283 TTTGCTTTCCATTTCTTTATAGG + Intronic
995462972 5:112421484-112421506 TTTCTTTTCCATTTCTTTATCGG + Intergenic
995580287 5:113592596-113592618 TTATTAGTCCAATTTTATATAGG + Intronic
995890852 5:116948977-116948999 TTAGAATTCTAATTCTTCTTGGG + Intergenic
996263300 5:121501311-121501333 TTACTATTAAAATTCTTAATGGG + Intergenic
996300667 5:121980237-121980259 ATAGTATTACAATTTTCTATAGG - Intronic
996762724 5:127002615-127002637 TTAGCATTCCAGTGCTGTATTGG + Intronic
996781021 5:127186700-127186722 TTAGAATTCCAATCCCTTAATGG - Intergenic
996897997 5:128508607-128508629 TTAGTATTTTAAATCTTTTTAGG - Intronic
997057785 5:130465511-130465533 GTAATATTCTATTTCTTTATAGG - Intergenic
1000206359 5:159063497-159063519 TTACTATTCCAACTATTTTTGGG + Intronic
1000584912 5:163085579-163085601 TTTGTATTTCAATAGTTTATTGG - Intergenic
1000623870 5:163516530-163516552 TGAGGATTCCTATTCTGTATGGG + Exonic
1000682766 5:164206640-164206662 TTATTATGCAAATTCTTAATAGG + Intergenic
1000916836 5:167092982-167093004 TTAATATTCCATGACTTTATCGG + Intergenic
1001423484 5:171605435-171605457 TTTGTATTCTAATTCTTTTGTGG + Intergenic
1002340667 5:178514797-178514819 TCAGAATCCCAATTCTTCATAGG + Intronic
1004038202 6:11945386-11945408 TAAATATTCTATTTCTTTATAGG + Intergenic
1004818115 6:19334483-19334505 CTAGTAATCAAATTTTTTATTGG - Intergenic
1005423552 6:25677976-25677998 TTAGTTTTTCAAATCTTTGTAGG - Intronic
1007466179 6:42052843-42052865 TAAGTTGTCCACTTCTTTATTGG - Intronic
1008103738 6:47420904-47420926 CTGGTATTTCAATTCTTTACTGG - Intergenic
1008175611 6:48264635-48264657 TTATTATTTCAATACTTTTTTGG - Intergenic
1008684083 6:53904831-53904853 TTATAATTCCAATTGCTTATGGG - Intronic
1009348285 6:62644635-62644657 TGAGTATTCAAATTCATTTTGGG + Intergenic
1010062435 6:71638930-71638952 TTTGTATTCCAAGTATTTAAAGG - Intergenic
1011964220 6:93133574-93133596 TTAGGATTCTAATGCTTTTTTGG - Intergenic
1011983237 6:93412210-93412232 TTTGTATTTGAATTTTTTATTGG - Intronic
1012203664 6:96436077-96436099 GTAGTAATCCACTTCTTTAAAGG - Intergenic
1012428366 6:99139576-99139598 TTGGTATTCAAATTCATTATGGG - Intergenic
1013941982 6:115675365-115675387 TCAGTATACAAATTCTTTGTTGG - Intergenic
1014413557 6:121154973-121154995 TTGGTATTCCAGCTCTTTTTTGG + Intronic
1015286769 6:131494444-131494466 TTAGTATTTCAATTATCTATAGG + Intergenic
1016126844 6:140414092-140414114 TTAGTATTCACTGTCTTTATTGG - Intergenic
1016572219 6:145527324-145527346 TAAGTATACAATTTCTTTATTGG + Intronic
1020399598 7:7760485-7760507 TTGGTATTCCAGTTATCTATTGG - Intronic
1021918306 7:25457262-25457284 TTAGTATACCCATTCTATAATGG - Intergenic
1022271226 7:28809750-28809772 TTATTATTCCCATTCTGTAGAGG - Intronic
1023278944 7:38550137-38550159 TAAGTATGCTGATTCTTTATTGG + Intronic
1024437395 7:49375444-49375466 TAAGTATTCCAATGCTTTTAGGG + Intergenic
1025822702 7:64984406-64984428 GTAATATTCTAATTCTTCATCGG - Intronic
1026237966 7:68545342-68545364 TTTAAATTCCAAGTCTTTATGGG + Intergenic
1029010554 7:97257462-97257484 TTAATATTCCAATGCTTTTTGGG + Intergenic
1029664315 7:101985070-101985092 TCATAATTTCAATTCTTTATTGG - Intronic
1030823450 7:114124410-114124432 TTAAAATTCAAATTCTTTTTTGG + Intronic
1036385960 8:8281817-8281839 TTAGGATTCCTATTCTGTAAGGG - Intergenic
1036835961 8:12067238-12067260 GAACTATTCCAATTTTTTATAGG + Intronic
1036857804 8:12313808-12313830 GAACTATTCCAATTTTTTATAGG + Intergenic
1037652988 8:20856790-20856812 TTACTATCCCAATTCTCTTTTGG + Intergenic
1038989522 8:32852589-32852611 TTAGGTTTCCATCTCTTTATTGG + Intergenic
1040453128 8:47568277-47568299 TTCGTAATACACTTCTTTATAGG + Intronic
1041131369 8:54705436-54705458 TTGGTATTCAGAGTCTTTATTGG + Intergenic
1041788766 8:61667254-61667276 TTAGTAGTCATATTCTTTGTGGG - Intronic
1043451281 8:80369778-80369800 TTAGTATTTCATTTCTCTATTGG - Intergenic
1043719339 8:83527201-83527223 TATGTATTCCAACTCTTTCTAGG - Intergenic
1044437438 8:92180826-92180848 TTTGGATACAAATTCTTTATTGG + Intergenic
1044895172 8:96884026-96884048 TTAGAATACCAATTGTTCATTGG + Intronic
1044921543 8:97174707-97174729 TTAGGATTCAAATTCTATTTAGG + Intergenic
1045805201 8:106151175-106151197 TTAGTCTTTCAATTATTTTTTGG + Intergenic
1046384547 8:113492073-113492095 TTAGTATTTCATTTCTTTTGTGG + Intergenic
1048399873 8:134055261-134055283 TTAGTTTTCCAATTCTACAGAGG - Intergenic
1048607860 8:135988542-135988564 TTATTATTCCCATTTTTTAAAGG - Intergenic
1049314174 8:141951164-141951186 TTACTATTGCAATTGTTTAGGGG + Intergenic
1050936520 9:11403142-11403164 TTCATATTCCAATTGTCTATTGG + Intergenic
1050966787 9:11814386-11814408 TAATTCTTCCAATTCATTATTGG + Intergenic
1051154750 9:14129014-14129036 TTATTTTTTCAATTCTTTTTTGG + Intronic
1051162449 9:14223483-14223505 TTAGCATTCCAATTTTTTTTAGG + Intronic
1051319335 9:15883843-15883865 TTATTATTCCTTTTCTTAATAGG + Intronic
1051593054 9:18795934-18795956 ACAGAATTCCAATTATTTATGGG - Intronic
1051773620 9:20609187-20609209 TTAGCATTCCAATTCTGTAAAGG - Intronic
1052128973 9:24817292-24817314 GTTATATTCCAAGTCTTTATTGG + Intergenic
1055533301 9:77210028-77210050 TTAGTATTCTAATTTGTTTTAGG + Intronic
1058501464 9:105622953-105622975 TCAGTCTTTCACTTCTTTATAGG + Intronic
1058576176 9:106404775-106404797 TTATTTTTCCCATTTTTTATTGG - Intergenic
1059607086 9:115844981-115845003 TTACTTTTCTAATTGTTTATAGG - Intergenic
1059858106 9:118424235-118424257 TAAGTAATCCAGATCTTTATAGG + Intergenic
1060629901 9:125146484-125146506 TAAGTGTTCCAACTCTTTAAAGG - Intergenic
1186591683 X:10936780-10936802 ATAGTATTCAAATCCTTTTTGGG + Intergenic
1186754927 X:12660634-12660656 ATAGTTTTCAAATTCTTTTTGGG + Intronic
1187626894 X:21124488-21124510 TGAGTATTCCAATTTTTCAATGG - Intergenic
1188290797 X:28385948-28385970 TTATTTTTCCAAATCTGTATTGG - Intergenic
1188583592 X:31745476-31745498 TTAATTTTCCATTTCTTTCTTGG - Intronic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1192193498 X:69013328-69013350 TTGCAATTCCAATTCTTTAAAGG + Intergenic
1194298077 X:92152051-92152073 TCAGTATTCCAATTTTTGAATGG + Intronic
1194450485 X:94040018-94040040 TTACTATTAAAATTCTTTTTAGG + Intergenic
1195607505 X:106824585-106824607 TTTGTATTTCATTTCTTTATTGG + Intronic
1196333388 X:114499069-114499091 TTACTATTCTAATTCTTTTGGGG - Intergenic
1196409369 X:115399862-115399884 TGGCTATTCAAATTCTTTATTGG + Intergenic
1197923678 X:131623797-131623819 TTATTATTCCAAGACTTTTTGGG - Intergenic
1197979752 X:132203123-132203145 TTACTTTTACAAATCTTTATAGG + Exonic
1198003541 X:132466672-132466694 GTAGTATGCCATTTCTTTATGGG + Intronic
1198459644 X:136850733-136850755 TTAGTTTTACAGTTGTTTATGGG + Intronic
1198635298 X:138691617-138691639 TGACTCTTCCAAATCTTTATAGG + Intronic
1199652296 X:149958466-149958488 TTATTATTTCAATTGTTTTTTGG + Intergenic
1199688237 X:150283552-150283574 TTGGTCTTTTAATTCTTTATTGG - Intergenic
1199722586 X:150552722-150552744 TTAGTATTGCACTTCCTTTTGGG - Intergenic
1200615685 Y:5377018-5377040 TCAGTATTCCAATTTTTGAATGG + Intronic