ID: 931586654

View in Genome Browser
Species Human (GRCh38)
Location 2:63837361-63837383
Sequence ACCCACATGAGAGAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931586654_931586659 -4 Left 931586654 2:63837361-63837383 CCTTTTTCCTCTCTCATGTGGGT No data
Right 931586659 2:63837380-63837402 GGGTGGCCTAGGATTTAGATGGG No data
931586654_931586662 6 Left 931586654 2:63837361-63837383 CCTTTTTCCTCTCTCATGTGGGT No data
Right 931586662 2:63837390-63837412 GGATTTAGATGGGTACAGATGGG No data
931586654_931586664 25 Left 931586654 2:63837361-63837383 CCTTTTTCCTCTCTCATGTGGGT No data
Right 931586664 2:63837409-63837431 TGGGAGCCAATATTGAGTATGGG No data
931586654_931586663 24 Left 931586654 2:63837361-63837383 CCTTTTTCCTCTCTCATGTGGGT No data
Right 931586663 2:63837408-63837430 ATGGGAGCCAATATTGAGTATGG No data
931586654_931586658 -5 Left 931586654 2:63837361-63837383 CCTTTTTCCTCTCTCATGTGGGT No data
Right 931586658 2:63837379-63837401 TGGGTGGCCTAGGATTTAGATGG No data
931586654_931586661 5 Left 931586654 2:63837361-63837383 CCTTTTTCCTCTCTCATGTGGGT No data
Right 931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931586654 Original CRISPR ACCCACATGAGAGAGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr