ID: 931586656

View in Genome Browser
Species Human (GRCh38)
Location 2:63837368-63837390
Sequence CTAGGCCACCCACATGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931586656_931586663 17 Left 931586656 2:63837368-63837390 CCTCTCTCATGTGGGTGGCCTAG No data
Right 931586663 2:63837408-63837430 ATGGGAGCCAATATTGAGTATGG No data
931586656_931586661 -2 Left 931586656 2:63837368-63837390 CCTCTCTCATGTGGGTGGCCTAG No data
Right 931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG No data
931586656_931586664 18 Left 931586656 2:63837368-63837390 CCTCTCTCATGTGGGTGGCCTAG No data
Right 931586664 2:63837409-63837431 TGGGAGCCAATATTGAGTATGGG No data
931586656_931586662 -1 Left 931586656 2:63837368-63837390 CCTCTCTCATGTGGGTGGCCTAG No data
Right 931586662 2:63837390-63837412 GGATTTAGATGGGTACAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931586656 Original CRISPR CTAGGCCACCCACATGAGAG AGG (reversed) Intergenic
No off target data available for this crispr