ID: 931586661

View in Genome Browser
Species Human (GRCh38)
Location 2:63837389-63837411
Sequence AGGATTTAGATGGGTACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931586654_931586661 5 Left 931586654 2:63837361-63837383 CCTTTTTCCTCTCTCATGTGGGT No data
Right 931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG No data
931586656_931586661 -2 Left 931586656 2:63837368-63837390 CCTCTCTCATGTGGGTGGCCTAG No data
Right 931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG No data
931586652_931586661 6 Left 931586652 2:63837360-63837382 CCCTTTTTCCTCTCTCATGTGGG No data
Right 931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG No data
931586650_931586661 7 Left 931586650 2:63837359-63837381 CCCCTTTTTCCTCTCTCATGTGG No data
Right 931586661 2:63837389-63837411 AGGATTTAGATGGGTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931586661 Original CRISPR AGGATTTAGATGGGTACAGA TGG Intergenic
No off target data available for this crispr