ID: 931586985

View in Genome Browser
Species Human (GRCh38)
Location 2:63840526-63840548
Sequence GAGTAGGCATTGGCCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931586985_931586996 19 Left 931586985 2:63840526-63840548 CCCACACAGGCCAATGCCTACTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 931586996 2:63840568-63840590 CCCCCAACCAGATGTGATGAGGG 0: 1
1: 0
2: 1
3: 9
4: 112
931586985_931586998 20 Left 931586985 2:63840526-63840548 CCCACACAGGCCAATGCCTACTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 931586998 2:63840569-63840591 CCCCAACCAGATGTGATGAGGGG 0: 1
1: 0
2: 0
3: 14
4: 129
931586985_931586994 18 Left 931586985 2:63840526-63840548 CCCACACAGGCCAATGCCTACTC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 931586994 2:63840567-63840589 TCCCCCAACCAGATGTGATGAGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931586985 Original CRISPR GAGTAGGCATTGGCCTGTGT GGG (reversed) Intergenic
900291204 1:1924312-1924334 GAGTAGGCAGTGGCCTGGAGGGG - Intronic
900316624 1:2060351-2060373 GTGTTGGCAGTGCCCTGTGTTGG + Intronic
906014052 1:42557421-42557443 CAGTGGACATTGGCCAGTGTGGG + Intronic
907418612 1:54331605-54331627 GATTTGGCATTTGCCTGTGCCGG + Intronic
915491761 1:156253947-156253969 GAGTAGGCAGTTGTATGTGTGGG - Intronic
920280951 1:204843218-204843240 GAGTAGTCCTTGGCCTATATTGG - Intronic
922220841 1:223557436-223557458 CAGTGGGCACTGGCCTGGGTGGG - Intronic
922253995 1:223875621-223875643 GAGAAGGCATAGACCTGTGAGGG - Intergenic
1062962459 10:1582930-1582952 GAGCAGTCATGGGCCTGTCTTGG + Intronic
1063193309 10:3718017-3718039 GAGTTAGCAATGGACTGTGTGGG + Intergenic
1063923230 10:10951927-10951949 GAGGAGCCATTGGTCAGTGTAGG - Intergenic
1064345183 10:14526080-14526102 GAGTAGGCATTGTTCTGTGACGG - Intronic
1067429424 10:46233297-46233319 GAGGTGCCCTTGGCCTGTGTGGG + Intergenic
1069805049 10:71116957-71116979 CAGTAGTCAGTGCCCTGTGTGGG - Intergenic
1070171760 10:73938207-73938229 GAGTAGGCAGTGGACTGCGGGGG + Intergenic
1070863226 10:79689656-79689678 GACGAGGCATTGGCAGGTGTGGG - Intergenic
1073108214 10:101045352-101045374 AACTAGGCATTGGCTTGTGCAGG - Intergenic
1076508867 10:130998302-130998324 GAGAAGGCATAGATCTGTGTGGG + Intergenic
1079755182 11:24250141-24250163 GAGGAGGCAGGAGCCTGTGTCGG - Intergenic
1083272318 11:61578761-61578783 GTGTGGGCATTGGGCTGGGTGGG - Intronic
1087083593 11:94195088-94195110 GAGGAGCCAGTGGCCTGTTTTGG - Intergenic
1088496541 11:110436950-110436972 GAGTAGGCTTTGTCCAGAGTTGG + Intronic
1088990591 11:114950162-114950184 GGGGAGGCATAGGCCAGTGTGGG + Intergenic
1092737128 12:11593115-11593137 GAGCAGGAATTGGCTTGAGTGGG + Intergenic
1097179171 12:57161118-57161140 GGGCAGGCATGTGCCTGTGTGGG + Intronic
1103627912 12:122234699-122234721 GAGAAGGCATTGGAGTGTGTTGG - Intronic
1105597110 13:21849253-21849275 GAGAAGGAATTGGGGTGTGTGGG + Intergenic
1112046277 13:95601552-95601574 GAGTAAGCTCTGGCCAGTGTTGG - Intronic
1112401294 13:99080844-99080866 GAGTAGGCCCTTGCCCGTGTAGG - Intronic
1113904065 13:113811295-113811317 GAGTGGGCCTGGGCCTGTGGGGG + Intronic
1115537560 14:34387414-34387436 GAGTAGGGGTTGGCATCTGTGGG - Intronic
1116118724 14:40694278-40694300 GATTAGGCAATGACCTGGGTGGG + Intergenic
1118613556 14:67559979-67560001 GAGTGGACACTGGCCTGTGTGGG - Intronic
1121014200 14:90538537-90538559 GTGCAGACATTGGACTGTGTGGG + Exonic
1122132963 14:99616434-99616456 GGGAGGGGATTGGCCTGTGTGGG + Intergenic
1122776369 14:104118613-104118635 GAGGAGGCACTGGCCAGTGGTGG - Intergenic
1127962764 15:63902017-63902039 GAATAGGCAATAGCCTGTCTGGG - Intergenic
1129605370 15:77022457-77022479 CAGTAGGCAGAGGCCTGTGCAGG + Intronic
1131374245 15:91910435-91910457 GAGCAGGCACTTGGCTGTGTGGG + Intronic
1131416808 15:92267006-92267028 GAGGAGGGGTTGGCCTTTGTTGG + Intergenic
1137516153 16:49146448-49146470 GATGAGGCATTGACCTGTGGTGG + Intergenic
1138982611 16:62288287-62288309 GAGTATGCACCAGCCTGTGTGGG + Intergenic
1141615816 16:85208833-85208855 GTGTTGGCGTTCGCCTGTGTTGG + Intergenic
1142104316 16:88294064-88294086 GAGGAGTCAGTGGCCTTTGTTGG + Intergenic
1142142141 16:88477231-88477253 GTGTGGGCTTTGGCCTGTGAGGG + Intronic
1142548271 17:720780-720802 GAGTATGCAGTAGGCTGTGTAGG + Intronic
1145999280 17:29121710-29121732 GAGGGAGCATTAGCCTGTGTGGG + Exonic
1147136477 17:38436807-38436829 GTGAAGACATTGGCTTGTGTAGG - Intronic
1148195620 17:45710596-45710618 CAGTAGGCATTGCCCTGGCTGGG - Intergenic
1153080790 18:1222226-1222248 GTGGAGGCATTGGCCTTAGTGGG - Intergenic
1154047859 18:10924103-10924125 GAGCAGGAATTGGGCTGTGGTGG - Intronic
1156070625 18:33202569-33202591 GATTTGGCATTGGGCTCTGTGGG + Intronic
1162935789 19:13980844-13980866 GAGTAGGCATTTGGATGCGTGGG - Intronic
1164725454 19:30462957-30462979 CCGTATGCATTTGCCTGTGTTGG + Intronic
1164725465 19:30463036-30463058 CCGTACGCATTTGCCTGTGTTGG + Intronic
1164725476 19:30463115-30463137 CTGTATGCATTTGCCTGTGTTGG + Intronic
925753289 2:7109331-7109353 GAGGTGGCAGTGGCATGTGTGGG - Intergenic
927362034 2:22247409-22247431 TCTTAGGCATTGGCCTGTGTTGG - Intergenic
931586985 2:63840526-63840548 GAGTAGGCATTGGCCTGTGTGGG - Intergenic
932813829 2:74845664-74845686 GAGCTGGCATTGGCCTGAGGTGG + Intronic
935311991 2:101793423-101793445 TTGTAGGCATTGGCCTGGCTGGG + Intronic
935357024 2:102210807-102210829 GAGTAGGTCATGGCCTGTATGGG + Intronic
935794438 2:106627859-106627881 GAGTTGGCTTTGGCCTGTGCAGG + Intergenic
937313951 2:120919460-120919482 CAGGAGGCTTTGGTCTGTGTGGG - Intronic
940770969 2:157839234-157839256 GAGTAAGCACTGGCCTCTCTCGG + Intronic
941037912 2:160587647-160587669 AAGTAGGCATTGGTCCTTGTTGG + Intergenic
941210266 2:162629114-162629136 AAGTCAGCGTTGGCCTGTGTGGG - Intronic
944395863 2:199265368-199265390 GAGGAGACATGGGGCTGTGTGGG - Intergenic
948917031 2:241039614-241039636 GGGCAGGCAGTGGCCTGTGCAGG - Intronic
1170736925 20:19020904-19020926 AAGTAGTGATTGGCCTGAGTGGG + Intergenic
1172185273 20:33027557-33027579 GAGTATGCCTTGGCAGGTGTTGG + Intergenic
1176363849 21:6020721-6020743 GAGTTGGCTTTTGGCTGTGTGGG + Intergenic
1177135825 21:17304557-17304579 GAGAAGGCATTTGCTAGTGTTGG - Intergenic
1178585242 21:33865929-33865951 GACTTGGCCTTGGCCAGTGTGGG + Intronic
1179759669 21:43517824-43517846 GAGTTGGCTTTTGGCTGTGTGGG - Intergenic
1181969452 22:26679327-26679349 GAGTAGGACTTGGCATGGGTGGG + Intergenic
1184225770 22:43128170-43128192 GAGTGGGCAGTGGCTTGTGAGGG + Intronic
1184916424 22:47571997-47572019 GAGTAGGCAATGGCCAATGGTGG - Intergenic
1185310542 22:50151866-50151888 GTGAAGGCCTTGTCCTGTGTGGG + Intronic
949463589 3:4320680-4320702 GAATAGGCAATAGCCTGTTTTGG + Intronic
949585295 3:5431256-5431278 GAGGATGCATGGGCCTGTGAAGG + Intergenic
951706150 3:25546105-25546127 GAGTATGCCCTGGCATGTGTAGG + Intronic
953435115 3:42871814-42871836 GAGTAGGCAAGGGCCTGAGCTGG - Intronic
954215982 3:49124783-49124805 GCGCAGGCATTGCCCCGTGTGGG + Exonic
955623254 3:60889046-60889068 GAGTAGGAATTGGAATGAGTCGG - Intronic
957642541 3:82875343-82875365 CAGTAGGCATTTGCACGTGTTGG - Intergenic
958025415 3:88042903-88042925 AAGTTGGCATGGGCCCGTGTGGG - Intergenic
959432098 3:106267432-106267454 GAGTAGAGATGGGCCTGTTTTGG + Intergenic
962706106 3:138046165-138046187 CAGTTGGGATTGGCCTGAGTTGG - Intergenic
963957304 3:151269033-151269055 GAGGAGACATTGGCCTCTCTGGG + Intronic
966775923 3:183542500-183542522 GAGTAGGCATTGGCCAGAAGGGG - Intronic
968490879 4:889979-890001 GAGCAGGCATTGGACAGTGGAGG - Intronic
968607612 4:1542884-1542906 GAGTAGGCCTTGGCCCGGGGGGG + Intergenic
970656687 4:18238501-18238523 GACAAGGCATTGGCCAGAGTGGG - Intergenic
970989798 4:22199625-22199647 GAATAGGCATTGGCCATTTTTGG + Intergenic
985098733 4:186436194-186436216 GAGTGGGCAATGTCGTGTGTGGG - Intronic
985298167 4:188457606-188457628 GTGTAGGCAATGTCCTGTGAGGG + Intergenic
985985823 5:3515403-3515425 GAGTAGGGAGTGGGCTGTGTTGG - Intergenic
990082553 5:51934775-51934797 GAGTTGGCATATGCCTGTTTTGG - Intergenic
990873595 5:60460645-60460667 GAGGAGACATTGGCCTCTGCAGG - Intronic
993337348 5:86677427-86677449 GAATTGGCATTGTCCTGAGTTGG - Intergenic
994920354 5:106034879-106034901 GAGTAGGCAGCTGTCTGTGTGGG - Intergenic
995011946 5:107266068-107266090 GAGTAGGTATTACCCAGTGTGGG - Intergenic
998184331 5:139967151-139967173 GAGGAGGCAATGGCCGGTGCTGG + Intronic
1001080385 5:168663203-168663225 GAGTAGGCTCTGGGCTGGGTGGG + Intronic
1001754368 5:174157114-174157136 GAGGCTGCAGTGGCCTGTGTGGG + Intronic
1005358579 6:25008813-25008835 GAGGAGCCATTGGCATTTGTGGG + Intronic
1005595516 6:27375106-27375128 GGGTAGGCACTCGCCTGTGGAGG - Intronic
1011198961 6:84813674-84813696 GAGTAGGGATTGGCGGGTGGTGG - Intergenic
1012930460 6:105310925-105310947 GAGTTGGCAGTGGGTTGTGTAGG - Intronic
1013166240 6:107594939-107594961 GAGAAGGCAGCGGCATGTGTTGG - Intronic
1014476146 6:121874282-121874304 GAGGTGGCATTGGCCAATGTTGG - Intergenic
1016896616 6:149059976-149059998 GAGAAAGTATTGGTCTGTGTGGG - Intronic
1018031717 6:159846412-159846434 GAGCTGGCCTGGGCCTGTGTGGG - Intergenic
1018931348 6:168242239-168242261 GAGTGGGCATGGGGCTGGGTGGG + Intergenic
1019055778 6:169222288-169222310 GAGTAGCCATAGGCCCGCGTGGG + Exonic
1019370584 7:660788-660810 GAGTAGGTATTTGCATCTGTTGG - Intronic
1019370871 7:661674-661696 GAGTAGGTATTTGCATCTGTTGG - Intronic
1020095987 7:5369617-5369639 GACTAGGGAAGGGCCTGTGTAGG + Intronic
1021395239 7:20139329-20139351 GAGTAGGCATTGTCCTGGTGTGG - Exonic
1021426612 7:20507019-20507041 GAGAAGTCATTAGCATGTGTGGG + Intergenic
1022533185 7:31079649-31079671 GAGAAAACAGTGGCCTGTGTTGG + Intronic
1024945875 7:54806799-54806821 AAGTAGGCATTTGGATGTGTGGG + Intergenic
1031964296 7:128016506-128016528 GAGTGGGCATGGGGCCGTGTGGG + Intronic
1034751656 7:153574588-153574610 GATGAGGCATTGGAATGTGTGGG + Intergenic
1035462676 7:159054067-159054089 GAGCAGGCAGTGGCATGTGTGGG - Intronic
1037091354 8:14923214-14923236 TAGAAGACATTGGCCAGTGTAGG + Intronic
1039846023 8:41326101-41326123 GAGTAGGCATTAAGTTGTGTGGG + Intergenic
1040111918 8:43570454-43570476 GGGAAGGCATTGACCTGTGGTGG + Intergenic
1042665734 8:71203548-71203570 GAGGAGTAATTGGCCTGTGGAGG + Intronic
1044518571 8:93169474-93169496 CAGTAGAAATTTGCCTGTGTAGG + Intergenic
1046005767 8:108481423-108481445 GAGTAGGCTTGGGGGTGTGTGGG + Intronic
1046689411 8:117266477-117266499 GAGTGGGCCTTGGCTTGTGATGG + Intergenic
1051166578 9:14268412-14268434 GACTAGACTTTAGCCTGTGTAGG - Intronic
1055717962 9:79139244-79139266 GAGTATGCATTGGAATGTATTGG - Intergenic
1056945924 9:90996772-90996794 GAATGGGCATTGGCCTATTTTGG - Intergenic
1187044205 X:15630013-15630035 GAGTAGGCATTCAACTGTATGGG + Intronic
1188029945 X:25253142-25253164 GGGCAGGCATTTGCCTGTGTTGG + Intergenic
1191252618 X:58266723-58266745 GGGAAGGCACTGGCCTTTGTGGG + Intergenic
1192478663 X:71466123-71466145 GAGTAGGACTTGGCATTTGTGGG + Intronic
1193698194 X:84735092-84735114 GATTAGGCAATGACCTGGGTGGG - Intergenic
1193700525 X:84755208-84755230 GAGGAGACATTGGCCTCTGCAGG + Intergenic