ID: 931590687

View in Genome Browser
Species Human (GRCh38)
Location 2:63880182-63880204
Sequence CAGAAAGAGGAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4318
Summary {0: 1, 1: 2, 2: 46, 3: 474, 4: 3795}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931590687_931590695 6 Left 931590687 2:63880182-63880204 CCCTCCTCCCTCTCCTCTTTCTG 0: 1
1: 2
2: 46
3: 474
4: 3795
Right 931590695 2:63880211-63880233 TCTCATTCTGTGGAGTACAGTGG 0: 1
1: 2
2: 14
3: 45
4: 254
931590687_931590694 -4 Left 931590687 2:63880182-63880204 CCCTCCTCCCTCTCCTCTTTCTG 0: 1
1: 2
2: 46
3: 474
4: 3795
Right 931590694 2:63880201-63880223 TCTGACAGGTTCTCATTCTGTGG 0: 1
1: 0
2: 3
3: 67
4: 533

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931590687 Original CRISPR CAGAAAGAGGAGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr