ID: 931598299

View in Genome Browser
Species Human (GRCh38)
Location 2:63975270-63975292
Sequence GTTCACCCTATGCCCAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 2, 2: 7, 3: 31, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931598299_931598302 -10 Left 931598299 2:63975270-63975292 CCATTCTTGGGCATAGGGTGAAC 0: 1
1: 2
2: 7
3: 31
4: 77
Right 931598302 2:63975283-63975305 TAGGGTGAACTAACTTTGGGAGG 0: 9
1: 118
2: 198
3: 238
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931598299 Original CRISPR GTTCACCCTATGCCCAAGAA TGG (reversed) Intronic
911798082 1:102099336-102099358 GTTCAGCCTATGCCCAGGAATGG - Intergenic
914329573 1:146654283-146654305 ATTCACCCTATGGCCAAAAGAGG - Intergenic
916024313 1:160820658-160820680 CTTTACCCTCTGCCCAAGGAAGG - Intronic
918051202 1:180974019-180974041 CTTCACCCTGTGTCCTAGAATGG - Exonic
920640192 1:207744280-207744302 GTTCAGTCTATGCCCAGGGATGG + Intergenic
920736333 1:208536288-208536310 CTTCACCCCATGCCAGAGAAAGG + Intergenic
922039832 1:221886177-221886199 GTTCTCCCTACCCCCAAGATTGG + Intergenic
923451253 1:234119544-234119566 GCTCAGCCTATGACCAAGAAAGG - Intronic
1068479942 10:57577895-57577917 GTTCAGCCTATGCACAGGGACGG - Intergenic
1068547346 10:58363159-58363181 GTTCACTTGATGACCAAGAATGG - Intronic
1072120536 10:92402058-92402080 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1075349526 10:121711102-121711124 GTTCACCCTATGGACAGGAGAGG - Intergenic
1076736642 10:132462039-132462061 TTTCACCCAAGGCCCAAGGAGGG - Intergenic
1076823634 10:132955998-132956020 GTTCAGCCTACGCCCCGGAATGG - Intergenic
1080028808 11:27638978-27639000 GTTCAGCCTACGCCCAGGAATGG + Intergenic
1080295811 11:30725980-30726002 GTGCAACTTATTCCCAAGAAAGG + Intergenic
1081661302 11:44889946-44889968 GTTCTCCCTGTGACCCAGAATGG + Intronic
1083013400 11:59425628-59425650 CTTCAGCTTATGCCCAAGAATGG + Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1085725051 11:78947830-78947852 GTTCCCTCCATGCCCAGGAAGGG + Intronic
1086327090 11:85713166-85713188 GTTCATCAAAGGCCCAAGAATGG + Intronic
1088053794 11:105551532-105551554 TTTCAGCCTATGCCCAGGAATGG + Intergenic
1090340250 11:126012138-126012160 CATAACCCAATGCCCAAGAATGG - Intronic
1094325714 12:29236328-29236350 TTACACCCTAAGCCAAAGAAGGG + Intronic
1095572817 12:43701758-43701780 CTTCAGCCTATGCCCAGGATGGG + Intergenic
1095887617 12:47205555-47205577 GTTCAGCCTATACCCAGGAATGG + Intronic
1102192963 12:111002762-111002784 GTTCAGCCTATGCCCAGGAATGG + Intergenic
1102326735 12:111992156-111992178 TTTAACCCTATACCTAAGAAAGG - Intronic
1103539643 12:121657110-121657132 GTTCAGCTTAAGCCCAGGAATGG - Intronic
1103680934 12:122693042-122693064 GTTCGGCCTATGCCCCAGCAAGG + Intergenic
1106439601 13:29754321-29754343 GTTCAGCCTATACCCAGGAATGG + Intergenic
1108179425 13:47826077-47826099 GTCCACCCTTGACCCAAGAAAGG - Intergenic
1110318774 13:74136302-74136324 GTTTACCCTAGGCCCAGGATCGG - Intergenic
1110953180 13:81520565-81520587 GTTCAGCCTATGCCCAGGGATGG - Intergenic
1113018638 13:105857010-105857032 GTTCAGCCTGTGCCCAGGAATGG - Intergenic
1113612393 13:111656573-111656595 CCTCACCCTGTGCCCACGAAGGG + Intronic
1113612455 13:111656834-111656856 CCTCACCCCATGCCCACGAAGGG + Intronic
1113770751 13:112906969-112906991 CTTCACCCTAAGCCCAAGTCAGG - Intronic
1114274851 14:21133748-21133770 GTTCACCTTATGACCCAGTATGG + Intergenic
1114999202 14:28401296-28401318 GTTCACCCAAGGACCAAGATGGG + Intergenic
1120252499 14:82075956-82075978 TTTTACCCTATGCCAAAAAAAGG - Intergenic
1121410224 14:93744377-93744399 GGGCACCCTGTGCCCAGGAATGG - Intronic
1122080078 14:99261040-99261062 GTTCACCCGATTCCAAAGAACGG + Intronic
1125690722 15:41594040-41594062 GTTCAGCCTATGCCCAGGAATGG + Intergenic
1126188611 15:45855418-45855440 GTTTACCGTGTGCTCAAGAAAGG + Intergenic
1131577906 15:93610672-93610694 GTTTAACCTATGCCTAGGAATGG - Intergenic
1139014797 16:62677189-62677211 GTTCAGCCTATGCCCAGGAAGGG - Intergenic
1140003988 16:71056652-71056674 ATTCACCCTATGGCCAAAAGAGG + Intronic
1140895329 16:79319729-79319751 TTTCACTCTATGCCCACAAATGG - Intergenic
1147505282 17:41010162-41010184 GTTCAACCTGTGGCCCAGAAAGG + Intronic
1148072604 17:44916852-44916874 ATTCAGCCTGTGCCCAGGAAAGG - Intronic
1148565678 17:48631620-48631642 GTTGGCCCTGTGCCCAGGAAAGG - Intronic
1149079825 17:52641875-52641897 CTTAACCCTATGCCCAGGAAAGG + Intergenic
1159138911 18:64369340-64369362 GTTCACCCAAGGACCAAGATGGG + Intergenic
925202690 2:1981676-1981698 GTCCTCCCCATGCTCAAGAAAGG - Intronic
926364565 2:12121424-12121446 GTTTACCAGATGCCCAAGAAGGG + Intergenic
928296466 2:30088429-30088451 GTTCAGCCTACACCCAGGAATGG - Intergenic
928363296 2:30682616-30682638 GTACACCCTATGCCCAGGTGGGG + Intergenic
928901313 2:36320690-36320712 ATTCAACATATGCCCAGGAATGG - Intergenic
930302735 2:49637850-49637872 GTTCAGCCTATGCCCAGGAATGG - Intergenic
930692419 2:54378211-54378233 GTTCACCTTCTGCCCCACAATGG - Intronic
931598299 2:63975270-63975292 GTTCACCCTATGCCCAAGAATGG - Intronic
932670727 2:73735589-73735611 GTTAAGCTTATGTCCAAGAAAGG - Intronic
933848890 2:86349692-86349714 GCTCACCCTATGCCCAAAGAGGG - Intergenic
936447595 2:112607914-112607936 GTTCGGCCTATGCCCAGGAATGG - Intergenic
938982370 2:136538990-136539012 GCTCACCCTGGGCTCAAGAAAGG + Intergenic
941209720 2:162622570-162622592 TTTCACCCCATCCCCAATAAAGG - Intronic
941960330 2:171246895-171246917 GTTCAGCCCATGTCCAGGAATGG + Intergenic
943984935 2:194606328-194606350 GTTCAGCCTATGCCCAGGGCTGG + Intergenic
944037594 2:195314456-195314478 GTTCACCCTAAGACCAAGACGGG + Intergenic
947129404 2:226905723-226905745 GTTCACTCTGTGCCCAACACTGG + Intronic
947555082 2:231085128-231085150 GTCCACCCCATTCCCAAGAAAGG - Intronic
1170509146 20:17058952-17058974 GTTCAGCCTATGCCCAGGAATGG + Intergenic
1171754416 20:29088947-29088969 TTTCACCCTCTGTCCAAGTAGGG - Intergenic
1175886222 20:62292357-62292379 CTTCACCCCATGACCCAGAAAGG + Intronic
1177332517 21:19681659-19681681 GTTCCACCTATGCCCAGGGATGG + Intergenic
949613480 3:5728194-5728216 GTTCGGCCTATGCCCAGGAATGG + Intergenic
950424596 3:12918256-12918278 GTGCACCCCATTCCCAAGAAGGG - Intronic
958750208 3:98186578-98186600 GTTCAGCCTATGCCCAGGGATGG - Intronic
959309557 3:104716690-104716712 ATTCACCATATGCCCAACATTGG + Intergenic
964961824 3:162437157-162437179 GTTCAGCCTATGCCCAGGGATGG - Intergenic
964961857 3:162437362-162437384 GTTCAGCCTATGCCCAGGGATGG - Intergenic
967760835 3:193224913-193224935 GTTTGGCCTATGCCCAGGAATGG - Intergenic
969260700 4:6031496-6031518 GTTCACCAGATGCACAAGAGGGG + Intronic
972215954 4:36896915-36896937 GTTCAGCCTATGCCCAGGGATGG + Intergenic
977389069 4:96384430-96384452 GTTCAGCTTATGCCCTGGAACGG + Intergenic
978457413 4:108909169-108909191 GTTCAACCTACGCCCAGGAATGG + Intronic
980145677 4:128981237-128981259 GTTCAGCCTATGCCCAGGAATGG - Intronic
987583076 5:19820693-19820715 GTTCCCCCAAGGCCCAGGAATGG + Intronic
988941534 5:36152392-36152414 ATTCACACTTTCCCCAAGAAGGG - Intronic
990956408 5:61344524-61344546 CCTCACCCCATCCCCAAGAAAGG - Intronic
992616667 5:78552003-78552025 GTTGAACCTATGCACAAAAATGG + Intronic
996476559 5:123929258-123929280 GTTCCGCCTGTGCCCAAGGATGG - Intergenic
997584709 5:135037527-135037549 AAACACCCTGTGCCCAAGAATGG + Intronic
1001224141 5:169929254-169929276 GTTTACCATATGGCCAAGGATGG - Intronic
1005119388 6:22372991-22373013 GTTCAGTCTATGGCCAGGAATGG + Intergenic
1007296562 6:40826740-40826762 GTTCAGCCAATGCAAAAGAAGGG - Intergenic
1010828831 6:80506176-80506198 GGTCATCCTAAACCCAAGAAGGG + Intergenic
1012580985 6:100870453-100870475 GGTCACCCTGAGCCCCAGAATGG - Intronic
1016981302 6:149857180-149857202 GTTCGGCCTATGCCCAGGAATGG - Intronic
1021518861 7:21518313-21518335 ATTTACCCTATGCCTAGGAATGG + Intergenic
1023932432 7:44713961-44713983 GTTCAGCCTATGCCCGGGAATGG - Intergenic
1028730617 7:94143851-94143873 CTTCACTCTATAACCAAGAAAGG - Intergenic
1031579843 7:123459450-123459472 GTTCACCCTGTCCCCAAGTAAGG + Intronic
1037493143 8:19414263-19414285 GTTCACCCTCTGCCAGAGATAGG - Intronic
1043250790 8:78070722-78070744 GTTCAGCCTATGCCCAAGAATGG - Intergenic
1047532169 8:125686658-125686680 GTTCATCATTTGGCCAAGAAGGG - Intergenic
1048361922 8:133704916-133704938 GTTCATCCCATGCCAATGAAGGG + Intergenic
1057815150 9:98289015-98289037 GTTCATTCTTTGCTCAAGAAAGG - Exonic
1061682577 9:132250284-132250306 GGTCTCCCCATGCCCAAGAAAGG + Intergenic
1186116732 X:6311670-6311692 GTTCAGCCTATGCCCAGGAGTGG + Intergenic
1188159522 X:26783194-26783216 GTTCAGCCTATGCCCAGGGATGG - Intergenic
1188563788 X:31501134-31501156 ATTTACACTATGCCCAAGTAAGG + Intronic
1194316644 X:92384963-92384985 GTTCAGCCTATTCCCAGGAATGG + Intronic
1195010733 X:100730734-100730756 GTTCATCCTCTGCCCAAAAAGGG + Intronic
1198726032 X:139677787-139677809 GTTACCCATATGACCAAGAAGGG - Intronic
1200136123 X:153875627-153875649 GCCCACCCTGTGCCCAGGAAAGG + Intronic
1200624820 Y:5498285-5498307 GTTCAGCCTATTCCCAGGAATGG + Intronic