ID: 931599214

View in Genome Browser
Species Human (GRCh38)
Location 2:63986412-63986434
Sequence TGTCATTTGCAACAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 4, 2: 9, 3: 42, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931599214_931599216 -2 Left 931599214 2:63986412-63986434 CCATCCATCTGTTGCAAATGACA 0: 1
1: 4
2: 9
3: 42
4: 249
Right 931599216 2:63986433-63986455 CAAGATCTCATCCTTTTCTATGG 0: 1
1: 11
2: 342
3: 9181
4: 23552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931599214 Original CRISPR TGTCATTTGCAACAGATGGA TGG (reversed) Intronic
900758387 1:4454023-4454045 TGTCCTGGGCAAGAGATGGAGGG - Intergenic
902279084 1:15361342-15361364 TGCCACTGGCAACTGATGGATGG - Intronic
903278879 1:22238869-22238891 TGTAATTTGCAACAAGTGGCGGG + Intergenic
904058035 1:27685320-27685342 TGTTATTTGCAAGGGATAGAGGG + Intergenic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906812205 1:48839413-48839435 TGTCATTTGCAACAACTAGATGG + Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907751350 1:57266265-57266287 TGTCATTTGCTACTCATGAAGGG - Intronic
908440736 1:64151366-64151388 AGTCATTTGCCAGAGATGAAAGG - Intronic
910545385 1:88410063-88410085 TGTCATTTGCCAAAAATAGAAGG - Intergenic
910733644 1:90427287-90427309 TGTCATTTGCAACAAATGGATGG + Intergenic
911093900 1:94040122-94040144 GGTCCCCTGCAACAGATGGATGG + Exonic
911681398 1:100719936-100719958 TAACATTTGAAACAGATGAAGGG - Intronic
911856243 1:102879866-102879888 TGTCATTTGCACCATATTGATGG + Exonic
911961407 1:104307756-104307778 TGTCACTTGCAAATCATGGATGG + Intergenic
912380345 1:109244394-109244416 TGCCATGTTCAACAGCTGGAAGG + Intergenic
913288220 1:117247469-117247491 TGCCATTTGCAACAGCGGGTAGG - Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
915105211 1:153530589-153530611 TGACATTTGCAACATATATAAGG + Intergenic
916247286 1:162701327-162701349 TGGCATTTGCAGTAAATGGAAGG + Intronic
917542987 1:175933494-175933516 TGGAATTTTCAACAGATGTAGGG - Intergenic
918382032 1:183965871-183965893 TGTAATTTCAAACAGATTGATGG - Intronic
918774492 1:188610745-188610767 AGTCATTTGCTGAAGATGGAAGG - Intergenic
919316379 1:195975708-195975730 TGTGATTTGCAACAAAGGGATGG - Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
921099367 1:211915159-211915181 TGTCATCAGCATCACATGGAGGG - Intergenic
921456486 1:215378179-215378201 TGTCAATTGCAACATTTGAAGGG - Intergenic
1065498049 10:26350223-26350245 TGTCCCTTGCAACTGATGAATGG + Intergenic
1066202786 10:33158403-33158425 TGGCATTTGCAGCAACTGGATGG + Intergenic
1069108785 10:64417320-64417342 TGTCATTTGCAGCAGAGTGAAGG - Intergenic
1069176512 10:65295819-65295841 TTTCAGTTGCAACCAATGGATGG - Intergenic
1069253888 10:66308123-66308145 TTTCATTTGCAAAAAATGCAGGG - Intronic
1069258924 10:66369687-66369709 TGTCATTTGCAAATGTTGGCCGG + Intronic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1070319026 10:75340563-75340585 TGTCCTTTTCAATAGATGCATGG - Intergenic
1071436899 10:85655784-85655806 TGTCATTTTAAAAGGATGGAAGG - Intronic
1072197666 10:93130488-93130510 TGTCACTTGCAACTGAAGGAGGG - Intergenic
1072728884 10:97831518-97831540 TCTCATTAGGAGCAGATGGAGGG + Intergenic
1074393128 10:113074429-113074451 TGACATTAGCAAGATATGGAAGG - Intronic
1074415590 10:113264420-113264442 TTTGATTGTCAACAGATGGAAGG - Intergenic
1074683760 10:115938690-115938712 AGTCATTTGCAACACATGAATGG + Intronic
1074700254 10:116086294-116086316 GTTCCTTTACAACAGATGGAAGG - Intronic
1075215960 10:120535107-120535129 TGTCATTTGCAATGAATGGCTGG + Intronic
1075285614 10:121183331-121183353 AGTCTCTTGGAACAGATGGATGG - Intergenic
1075767459 10:124905020-124905042 TGTTATTTCCAAATGATGGAAGG - Intergenic
1077939155 11:6821589-6821611 TGTCATTTGTGACATATAGATGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078945688 11:16066585-16066607 TGTCATTTGCAACAACATGATGG + Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086236564 11:84638251-84638273 TGTCCTTGGCACCAAATGGAAGG + Intronic
1087021660 11:93609209-93609231 AGACATTTGCATCAGAGGGAAGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1092893649 12:12992658-12992680 TGTCAGATTCACCAGATGGAGGG - Intronic
1093793426 12:23282811-23282833 TGTCATTTGCAGCAGAAACATGG - Intergenic
1093819879 12:23601235-23601257 TGCAATTTGCAAAAAATGGAAGG - Intronic
1093944614 12:25093319-25093341 TGTCTTTTTCAACAGATGGCTGG + Intronic
1094592086 12:31831344-31831366 TGGCATTTGCAGCAACTGGATGG + Intergenic
1096936038 12:55277608-55277630 TGCCATTTGAATCAGAAGGAAGG + Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1098045148 12:66392717-66392739 TGCCATCTGTAACAAATGGATGG + Exonic
1098118439 12:67206702-67206724 TGTCATTTGCACAACATAGATGG + Intergenic
1098929499 12:76394526-76394548 TGGCATTTGCAGCAGAAGCATGG - Intronic
1099186883 12:79524807-79524829 TGTCATTTGCATTATTTGGATGG - Intergenic
1100130199 12:91483183-91483205 TGTGATTTGCAAAAGATGAGAGG - Intergenic
1100268521 12:93001355-93001377 TGTCATTTGCAAAACAGAGATGG - Intergenic
1101143156 12:101816881-101816903 TGTAATTTGCAGCGCATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1103671008 12:122615276-122615298 TTTCATTGGAAACAAATGGAAGG + Intronic
1104910456 12:132237863-132237885 GGTCACATGCCACAGATGGAGGG - Intronic
1105350286 13:19608808-19608830 TGACATTTGGTACACATGGATGG - Intergenic
1105949299 13:25215092-25215114 TGTCATTGTTACCAGATGGAAGG - Intergenic
1106025496 13:25951908-25951930 TGTCACCTGCAACTGATGGCGGG - Intronic
1106883956 13:34162597-34162619 AGTCATTTGCCACAGAGGGCAGG + Intergenic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110646374 13:77890210-77890232 TGTGATTTGGAAGAGATGTATGG - Intergenic
1111062892 13:83046284-83046306 TGCCATTTGCCACACATGAATGG - Intergenic
1111711117 13:91815621-91815643 TGTCATTGACAGCAGCTGGAGGG - Intronic
1114634782 14:24181399-24181421 TGTCAGTTGCACCTGATGCAAGG - Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115022662 14:28701712-28701734 TGACATTTGTTAAAGATGGAAGG + Intergenic
1115329079 14:32174669-32174691 TGTCTTTTGCAGCATGTGGATGG - Intergenic
1115375008 14:32665204-32665226 TGTCATATCCCACAGATTGATGG + Intronic
1115656949 14:35452358-35452380 AGTCATTTACAACAACTGGATGG - Intergenic
1115740197 14:36379289-36379311 TCTCATTTCCTACAGCTGGAGGG - Intergenic
1116034204 14:39608426-39608448 TGTCATCTGCAACACATGTATGG - Intergenic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119586031 14:75836228-75836250 TGTCATTTGCAACAACATGATGG + Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1120169271 14:81232691-81232713 TGGCCTATGCAAAAGATGGATGG + Intergenic
1120421329 14:84290114-84290136 TGTCATATGCCACAGACTGATGG + Intergenic
1121149239 14:91615597-91615619 TGTGATTTGCAACAAAATGATGG - Intronic
1122384734 14:101336609-101336631 TGTCCTTCCCAACAAATGGAAGG - Intergenic
1122649047 14:103215477-103215499 TGTCATTTGCAACAACATGAGGG - Intergenic
1123689542 15:22825887-22825909 TCCCATTTGGAACACATGGATGG - Exonic
1124986371 15:34620067-34620089 TGTCATTGACAGCAGCTGGAGGG - Intergenic
1126828426 15:52574451-52574473 TGTCATTTGCAGCAACTGGATGG - Intergenic
1127459374 15:59183986-59184008 TGTCATTTGCAACAACACGATGG - Intronic
1127806419 15:62525262-62525284 TGTCATTTTCAACAAAATGAGGG + Intronic
1127936542 15:63645538-63645560 TGCCATTTACAATAGATGGATGG + Exonic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1133527042 16:6615785-6615807 TGCCATTAACAGCAGATGGATGG + Intronic
1133734503 16:8603890-8603912 CATCAATTGCAACAGATGGTGGG - Intergenic
1135279604 16:21142505-21142527 TATCATTTGCAATAAATAGAAGG + Intronic
1135580607 16:23622968-23622990 TGACGTTTGCAGAAGATGGAGGG - Exonic
1135930140 16:26729373-26729395 TTTCATTTGTTAGAGATGGAAGG + Intergenic
1136120729 16:28131907-28131929 GGCCATTTGCAACAGGTGCAGGG + Intronic
1136404395 16:30035589-30035611 TTTCAATGGCCACAGATGGATGG - Intronic
1137459150 16:48642826-48642848 TGTCATTTGCAGCAAATAGGTGG - Intergenic
1137578210 16:49617786-49617808 GGTCAGTGGCATCAGATGGAAGG - Intronic
1140807776 16:78548961-78548983 TGGCATTTCCAACAGATGGATGG + Intronic
1141260244 16:82446909-82446931 TGGCATTTGCAGCACCTGGATGG + Intergenic
1141694073 16:85611786-85611808 CGTCATCGGGAACAGATGGATGG + Intronic
1142537678 17:630922-630944 TGGCATCTGCTACAGTTGGAAGG + Intronic
1143707368 17:8708152-8708174 AGGAACTTGCAACAGATGGAAGG + Intergenic
1148721634 17:49757591-49757613 TGTTGTTGGCAACAGCTGGATGG - Intronic
1150841350 17:68609793-68609815 TGTCAGTTTTAACACATGGATGG - Intergenic
1151201798 17:72473992-72474014 TGGCATTTGCAGCAACTGGATGG + Intergenic
1152398178 17:80047931-80047953 TGTCATTTGCAAGTAATGAAAGG - Intronic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1153871497 18:9324841-9324863 TGTCATTTGCAACAACTTGGAGG + Intergenic
1154461018 18:14586252-14586274 TGTTATTTGCAAAGCATGGATGG + Intergenic
1157953817 18:52071987-52072009 TGTCATTTGCAACAGTATGGAGG - Intergenic
1159563853 18:70025664-70025686 GGTCATCTGCTGCAGATGGAGGG - Intronic
1159602654 18:70443317-70443339 TGTGATTTGTAAGAGAAGGAGGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1162272261 19:9625797-9625819 TGCCATTTGTAACAAATGGAAGG + Intronic
1162870697 19:13584318-13584340 TGTCTTTTGCAACATATGTGGGG + Intronic
1164254075 19:23512011-23512033 TGTAATTTGCAATTCATGGAAGG - Intergenic
928863510 2:35889523-35889545 TGTCACTTGCAACAAATGGATGG - Intergenic
929610277 2:43265871-43265893 TCTCATTTGGAACAGATTAAGGG + Intronic
929914671 2:46124584-46124606 GGTCATTTTTAACAGAAGGAGGG - Intronic
930455782 2:51605847-51605869 TATAATTAGCAACAGCTGGATGG - Intergenic
931002893 2:57808893-57808915 TGTCATTTGCTATTGATGGCAGG - Intergenic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931599214 2:63986412-63986434 TGTCATTTGCAACAGATGGATGG - Intronic
932482125 2:72049865-72049887 TGTCTTTTGCTATAGTTGGATGG - Intergenic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933500545 2:83105417-83105439 TCTCATTTGCTACAAATGGAAGG + Intergenic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
936095189 2:109525876-109525898 TGTCATTGGAAGCAGATGGAGGG + Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
938556502 2:132429557-132429579 TCTCATTTGGAAGAGAAGGATGG + Intronic
939135499 2:138288643-138288665 TCTCATATGCAACAGATAGGAGG + Intergenic
939409347 2:141804116-141804138 TGTCATTTGAAAATTATGGAAGG - Intronic
941019035 2:160388602-160388624 TGTCATTTGGAAGAGTTGAAAGG - Intronic
942222982 2:173789628-173789650 TGTCTCTTGCCTCAGATGGATGG - Intergenic
943484230 2:188458997-188459019 AGTCATTTGCAACAAATGGATGG - Intronic
944004886 2:194892338-194892360 TGTCATTTGCAACAACATGAAGG - Intergenic
944620972 2:201515800-201515822 TGCCATTTGCCACAGGTGGGTGG - Intronic
944990020 2:205224725-205224747 TATCTTTTCCAACAAATGGATGG - Intronic
945353357 2:208808431-208808453 TGTAATTTCCATTAGATGGAGGG + Intronic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
1168736698 20:146190-146212 TGTGATTTTCTACAGATTGAAGG + Intergenic
1169872431 20:10262386-10262408 TGTCATTTGTCACAGGAGGAAGG - Intronic
1169975236 20:11318148-11318170 TGGCATTTGCAGCAAATAGATGG - Intergenic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1173099524 20:40072471-40072493 TGCCATTTGGAACACATAGATGG + Intergenic
1173178673 20:40785124-40785146 AGTCATTTGCAACAACAGGATGG - Intergenic
1176813484 21:13571588-13571610 TGTTATTTGCAAAGCATGGATGG - Intergenic
1177207443 21:18026552-18026574 TGGCATATGGAACAGATGCATGG + Intronic
1178114677 21:29405058-29405080 TGTCATTTGGAACAGTTTGGAGG + Intronic
1178576050 21:33792733-33792755 TGACATGTGGAACAGAGGGAAGG - Intronic
1178900646 21:36595657-36595679 TTTCATATGCAAGAGAGGGAGGG - Intergenic
1184591138 22:45484188-45484210 TGTCAATTGCAACACACAGAGGG - Intergenic
1184898517 22:47427191-47427213 TGACAGATGCAAAAGATGGATGG + Intergenic
952516198 3:34106668-34106690 TGTCATTTGGGACAGAGGGCAGG + Intergenic
952538818 3:34344669-34344691 AGTCATTTGCAACAACTGGAAGG + Intergenic
953568844 3:44055920-44055942 TGTCATTTTTGACATATGGATGG + Intergenic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
954122713 3:48509223-48509245 TCTCATTTGCATCAGAAGGATGG - Intergenic
954883833 3:53854816-53854838 TGTCCTTTTCAAATGATGGATGG + Intronic
955287866 3:57661132-57661154 TGTCACTTGCTACAGATGGAAGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957221061 3:77382721-77382743 CGTCTTTTGCAGCAAATGGATGG - Intronic
958023462 3:88023885-88023907 TGTCATTTGCAGCAACTGGATGG + Intergenic
958492093 3:94789110-94789132 TTTCATTGGGAATAGATGGATGG - Intergenic
959543523 3:107568614-107568636 TGGAATTGCCAACAGATGGAAGG + Intronic
960167941 3:114425279-114425301 TGACATTTGCAAGAGATGACTGG + Intronic
962728319 3:138256118-138256140 TTTTATTTGCAACAGATGAATGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
971469895 4:27011907-27011929 TGTCTTTTTCAACAGATGATAGG + Intronic
972297616 4:37755180-37755202 TGTTATTTGTAAAAAATGGAAGG + Intergenic
973120983 4:46520928-46520950 TGTTATTTGCAGAAGATGGCAGG + Intergenic
973182090 4:47281726-47281748 TGTTATTTGTAACAAATGGATGG + Intronic
974143222 4:57915224-57915246 TGTCTGTTGCAACAGAAGGAAGG + Intergenic
975463110 4:74677639-74677661 TGTCATTTGCAACAACACGATGG - Intergenic
977673624 4:99723959-99723981 TGGCATTTAAAACAGCTGGATGG + Intergenic
978400167 4:108322712-108322734 TGTCATTTGCAACAACAGGATGG + Intergenic
979959720 4:127002779-127002801 TGTGATTTGAAACAGATGTCAGG + Intergenic
980993486 4:139758986-139759008 TGTGATTTTTCACAGATGGATGG - Intronic
981039239 4:140207614-140207636 TGTCATTTGCAACAACATGATGG - Intergenic
981453302 4:144924417-144924439 TGTCATTTGCAATAACTGGATGG - Intergenic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
983158926 4:164385572-164385594 TGTCATTTGCAACAACATGAAGG + Intergenic
983809721 4:172045998-172046020 TGCTATTTGCAAGACATGGATGG - Intronic
984995836 4:185429048-185429070 TATCATTTCCAACAGATAAATGG + Intronic
986081714 5:4401222-4401244 TGTCACTTCCAGCAAATGGATGG - Intergenic
986747412 5:10757042-10757064 TGTTATTTACAAGTGATGGATGG - Intronic
987201862 5:15585207-15585229 TGTAATTTGCATTAGATGAAAGG + Intronic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988845554 5:35124147-35124169 TGTAATTTCCACCAGTTGGAAGG - Intronic
988900560 5:35727889-35727911 TGTCATTTGCAACATCCTGAAGG + Intronic
989033930 5:37149970-37149992 TGTCTTTTGCTACACATGGTGGG - Intronic
989550013 5:42723553-42723575 TGTCTTTTGCTACATATGCAAGG - Intergenic
990723346 5:58724089-58724111 TGACATTTGCAAAAGAGAGATGG - Intronic
991614989 5:68486921-68486943 TGTTATTTGCTACAATTGGATGG - Intergenic
992210899 5:74478575-74478597 TGTTATTTGCAAATGATGTATGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
995010468 5:107252063-107252085 TGTAATTTCCAACATAGGGAAGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
996492099 5:124110172-124110194 TGTCTTTAGGAAGAGATGGAAGG - Intergenic
996795853 5:127345998-127346020 TGACATTTGCAGCACCTGGATGG - Intronic
997334629 5:133098213-133098235 TGTCTTTTGCAGCAACTGGATGG - Intronic
997431433 5:133843765-133843787 TGTGATGTGCAAGGGATGGACGG + Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998634406 5:143937020-143937042 TGTCATTTGCACAGCATGGATGG + Intergenic
998884900 5:146684128-146684150 TGTTATATGCAACAAATGTAAGG + Intronic
1000128088 5:158267172-158267194 TATTATTTGCAACAGATAGCTGG + Intergenic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1001015863 5:168140433-168140455 TGCCATTTGGAGCAGATGGAAGG - Intronic
1007452438 6:41950478-41950500 TCTCATTTGCAAAAGGAGGATGG + Intronic
1007552117 6:42738118-42738140 TGTCATTTGCAACAAATGGATGG + Intergenic
1007962916 6:45977432-45977454 TTTAATTTACAAAAGATGGAGGG - Intronic
1008252795 6:49260878-49260900 GGTCATTTGCAACAGCTGCCTGG + Intergenic
1012581759 6:100878915-100878937 TGTCATATCCCACAGATTGAAGG + Intronic
1013082964 6:106828702-106828724 TGTAAGTAGCAAGAGATGGAGGG - Intergenic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014879900 6:126710864-126710886 TTTCATTTGCACCAAATGAAGGG - Intergenic
1016271820 6:142299263-142299285 TGTCATTTGTGACACGTGGATGG - Intergenic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1024588039 7:50857947-50857969 TGTCAGCTGCTGCAGATGGAAGG - Intergenic
1025114705 7:56247767-56247789 TATCATTTGTAAAACATGGAGGG - Intergenic
1025164418 7:56699350-56699372 TGTCATTTCAACAAGATGGATGG + Intergenic
1027375015 7:77539497-77539519 TGTCATTTACAGCAATTGGATGG + Intronic
1028172670 7:87617447-87617469 TGTGTTTTGCCTCAGATGGAAGG - Intronic
1030191399 7:106813861-106813883 GGTCTTTTGCACCAGAAGGATGG - Intergenic
1031382476 7:121104425-121104447 TGTGATTTACAACGGATGAAGGG - Intronic
1032678548 7:134157276-134157298 TGTCATCTGCAGCAAATGGGTGG - Intronic
1032728774 7:134616905-134616927 TGTCAATAGCAACAGAGAGAAGG + Intergenic
1032962267 7:137050053-137050075 TGTCATTTGCACCATTTGGAAGG - Intergenic
1033147897 7:138886795-138886817 TGTCATTTGCAAAAGGCTGAGGG - Intronic
1033649413 7:143329500-143329522 GGTCATTTGCACCAGGGGGAGGG - Intronic
1033685339 7:143635216-143635238 TGTCATTTTCACCATATTGAAGG - Intronic
1033688509 7:143714434-143714456 TGTCATTTTCACCATATTGAAGG - Intronic
1033699276 7:143822404-143822426 TGTCATTTTCACCATATTGAAGG + Intergenic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1039001752 8:32988918-32988940 TGTCATTTGCAACAACACGATGG - Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1042637783 8:70897191-70897213 TGTCATTTGCAACAACAGCATGG - Intergenic
1043742237 8:83828539-83828561 GGTCTTTGGCCACAGATGGAAGG - Intergenic
1044031120 8:87238760-87238782 TCTCATTTTCAACAGTTAGAGGG - Intronic
1045944602 8:107781389-107781411 TGTCTTTAGCATCAGCTGGAAGG + Intergenic
1046457651 8:114487996-114488018 TGACATTTGCAGCAATTGGATGG + Intergenic
1047828082 8:128600234-128600256 TCTCATTTGCCACAAATAGAAGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1050081893 9:1924128-1924150 GGTCAAATGCAAGAGATGGATGG - Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051212427 9:14758655-14758677 TGTCTTTTTCATCAGATGGTGGG + Intronic
1051516048 9:17931444-17931466 TGTCATTTGGAAAAGTTGGGAGG + Intergenic
1052423718 9:28276579-28276601 AGACTTTTCCAACAGATGGAAGG - Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053049232 9:34945062-34945084 TGTCATTTGGAAGACATGGGGGG - Intergenic
1055168893 9:73230414-73230436 TGTTGTTGGCATCAGATGGAAGG - Intergenic
1056004676 9:82256403-82256425 TGGCATTTGCCACAGGTGCATGG - Intergenic
1056567871 9:87790773-87790795 TGTCATTTGCGTGAAATGGATGG + Intergenic
1058205440 9:102100325-102100347 TCTCATTTACTACAGCTGGAAGG + Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1185504463 X:620856-620878 TGTACTTTGCAACATATGGTGGG - Intergenic
1185681253 X:1890167-1890189 TGTCATTAGCAACAGGTTGGAGG - Intergenic
1186927158 X:14346785-14346807 TGTCATTTGTAAAACATGGATGG - Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188419141 X:29975183-29975205 TGTCATTTGAACAACATGGATGG - Intergenic
1188836705 X:34966335-34966357 GGTCATTTGCAACAGCATGATGG - Intergenic
1188846060 X:35073961-35073983 TCTCATAGGCAACAGATGAAAGG + Intergenic
1189214136 X:39308887-39308909 TGTCACTTGCAACCGAGGGGTGG - Intergenic
1191040653 X:56075818-56075840 TGTCATTTGCAACAACTGGGTGG - Intergenic
1191148529 X:57194886-57194908 TGGCATTTGCAGCAACTGGATGG - Intergenic
1191689046 X:63921248-63921270 TGTCTTTTGCCACAAATGGAAGG - Intergenic
1193598388 X:83477218-83477240 AGCCATTTGCAGAAGATGGAAGG + Intergenic
1194118167 X:89927903-89927925 TATCTTTTGCAACAGGTAGAAGG + Intergenic
1194761038 X:97796308-97796330 TATCATTTGCCATAAATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195961588 X:110392956-110392978 AGACATGTGCAACAGATGCAAGG + Intronic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196643035 X:118085736-118085758 TGTCTTTTGCAGCAATTGGATGG - Intronic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199744021 X:150760608-150760630 TTTCATTTGCAACAAATCAAGGG - Intronic
1199762929 X:150919070-150919092 TTTCATTTTCAAGAGATGAAGGG - Intergenic
1201336343 Y:12884497-12884519 TGTTTTTTGCAGCAAATGGATGG - Intergenic
1201505302 Y:14692907-14692929 TATCAATGGCAAGAGATGGATGG - Intronic