ID: 931601345

View in Genome Browser
Species Human (GRCh38)
Location 2:64006467-64006489
Sequence ATTAGGAAACAGACTTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931601345_931601350 14 Left 931601345 2:64006467-64006489 CCTTCCTAAGTCTGTTTCCTAAT 0: 1
1: 0
2: 4
3: 58
4: 383
Right 931601350 2:64006504-64006526 AGCAGCAGTATCTTCCTCATAGG 0: 1
1: 0
2: 7
3: 32
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931601345 Original CRISPR ATTAGGAAACAGACTTAGGA AGG (reversed) Intronic
903116712 1:21184273-21184295 GTTAGGAAACTTACTTAGGGTGG - Intergenic
903423169 1:23233290-23233312 ATGAGGAAACAGATTTAGAGAGG + Intergenic
904068776 1:27776303-27776325 ATTAGGAAACAAACTAAGAAAGG + Intronic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
905909775 1:41645875-41645897 ATGAGGGAACAGACCTAGAAAGG - Intronic
907403348 1:54239111-54239133 ATTAGAAAGCAGACTTACGTTGG + Exonic
908395251 1:63719505-63719527 ATAAGGAAACAGACACATGAGGG - Intergenic
908938493 1:69404143-69404165 GTAAGGAAACAGACTAAGAAAGG + Intergenic
909093142 1:71252633-71252655 AATAGGAGAGAGATTTAGGAAGG + Intergenic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
910036875 1:82799339-82799361 ATCAGGAAAGAAACTGAGGAAGG - Intergenic
910473035 1:87575962-87575984 ATGAGGAAATAGGCTTAGAATGG + Intergenic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
912827398 1:112918254-112918276 ATTAGGAAGCAGTCATAGGAGGG - Intronic
913121058 1:115741184-115741206 ATTTGGAAACAGATTTTGGAGGG - Intronic
913515598 1:119603047-119603069 ATTAGGAGACAGACATAGAGAGG + Intergenic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914256436 1:145963819-145963841 ATGAGGAAACAGACTTAATAAGG + Intronic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
914973441 1:152333211-152333233 ATGAGGAAACAGACCCAGAAAGG - Intergenic
916211877 1:162366369-162366391 ATGAGGTAACAGACTCAGGGAGG + Intronic
916880032 1:169011819-169011841 ATGAGGAAGCAGGCTTAGGGAGG - Intergenic
917834954 1:178934066-178934088 ATGAGGAAATACACTTGGGAGGG - Intergenic
918595718 1:186290464-186290486 ATTAGAAATCAGACATATGATGG + Intergenic
918696795 1:187554863-187554885 AATAGGAAACATATTTAGGAAGG + Intergenic
919070381 1:192748048-192748070 AATCAGAAATAGACTTAGGAGGG + Intergenic
920090564 1:203450068-203450090 ATTAGGTAAAAGATTTGGGAGGG - Intergenic
920729394 1:208468634-208468656 ATGAGGAAACAGATTCAGAATGG + Intergenic
922495181 1:226051581-226051603 ATGAGGAAATAGGCTAAGGAAGG - Intergenic
923295103 1:232586972-232586994 AATAGGAAACAGACATACAAGGG + Intergenic
924573215 1:245256936-245256958 ATCAGGAAAAAGACCTGGGAAGG - Intronic
1062775477 10:142502-142524 ATGAGGGAATAGACTTAGAAGGG + Intronic
1063653403 10:7962987-7963009 ATTAGGAAACAGGCTCAGAGAGG + Intronic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1064893354 10:20205806-20205828 ATGAGGAAACAGGCTTAGAAAGG + Intronic
1065538278 10:26735754-26735776 ATAAGGAAACAGTCTTAGCAAGG - Intronic
1066046044 10:31596468-31596490 AATAGGGAACAAATTTAGGATGG + Intergenic
1066435066 10:35390244-35390266 AGTAGGAAGCAAACCTAGGATGG + Intronic
1066548423 10:36527262-36527284 ATTAAGAAATAGACTGAGCACGG - Intergenic
1067752346 10:48980016-48980038 ATTAGGAAACTTACTTAAGGGGG + Intronic
1068084447 10:52357820-52357842 ATTAAAAAACAGAGTTAGTATGG + Intergenic
1069302415 10:66925213-66925235 ATGAGGAAACAGACTTGGGGAGG - Intronic
1070354251 10:75624221-75624243 ATTAGGAGAAAGACTAAGGGAGG + Intronic
1071269767 10:83996173-83996195 ATTAGGTCACAGACTGAGTAGGG + Intergenic
1072028567 10:91492144-91492166 ATCAGGAAACAGAATTAGAGAGG - Intronic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072415899 10:95246641-95246663 ATGAGAAAACAGACCTGGGAAGG + Intronic
1072509905 10:96110734-96110756 AGAAGAAAACTGACTTAGGAAGG + Intergenic
1072665051 10:97386565-97386587 CTTAGGAAACAGGATTTGGAGGG + Intronic
1072862406 10:99020352-99020374 ATGAGTAAACAGACATAGAAAGG + Intronic
1073227597 10:101936538-101936560 CTTAGGAAACACTCTGAGGAAGG + Intronic
1074072392 10:110085807-110085829 ATTAAGAAACAGACTTGGGCCGG + Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074672253 10:115805105-115805127 ATTAGGAGGTAGAATTAGGAGGG - Intronic
1074811241 10:117107238-117107260 ATGAGGAAACAGTTTTGGGACGG + Intronic
1074863006 10:117527069-117527091 CTTAGGAAACAGACAGAGAAAGG + Intergenic
1075904397 10:126068344-126068366 TTTAGGACCCAGATTTAGGATGG - Intronic
1076896653 10:133316539-133316561 CTTAGGACACAGAGATAGGAAGG + Intronic
1078404380 11:11056878-11056900 GTTAGGAAACAGACTTTGAAAGG + Intergenic
1078671707 11:13371514-13371536 AGTAGAAAACAGAAGTAGGAAGG - Intronic
1078746211 11:14117872-14117894 ATAAGGAAACAGGCTCAGGGAGG - Intronic
1079015338 11:16863855-16863877 ATCAGGAAAGAGGCTTAGAAGGG + Intronic
1079237234 11:18699313-18699335 GTTAGGAAACAAACTTGGGACGG - Intronic
1079922570 11:26451077-26451099 ATTAGAAAACAGACTTATAGGGG + Intronic
1079975051 11:27080630-27080652 ATAAGGACACAGACTCAGGCAGG + Intronic
1080549735 11:33362275-33362297 ATCAGGAAACACAAGTAGGATGG + Intergenic
1080582788 11:33657485-33657507 ATGAGGAAACAGGCTTGGAAAGG + Intronic
1080623402 11:34006754-34006776 ATGAGGAAACAGCCTTAGTGAGG - Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080984223 11:37442575-37442597 ATTATTAAACAGACATATGATGG + Intergenic
1081032611 11:38104271-38104293 ATTAAGACACATACTTCGGAAGG - Intergenic
1081744858 11:45465678-45465700 TTAAGGAAACAGAGTTAGGCTGG + Intergenic
1081895485 11:46582151-46582173 ATGAGGATAGAGACTTAGGCAGG - Intronic
1082075090 11:47970029-47970051 ATTAAGAAATAGACTTAGCGAGG + Intergenic
1082086479 11:48054504-48054526 GTGAGGAAACAGACTTGGAAAGG + Intronic
1083336566 11:61925148-61925170 ATGAGGAAACAGATTTGGAAAGG + Intergenic
1083786695 11:64953238-64953260 GTAAGGAAACAGACTCAGGGAGG + Intronic
1083809297 11:65094589-65094611 ATTAGGACACAGAGTTGGAATGG - Intronic
1084344758 11:68539278-68539300 ATGAGGAAACAGACCCAAGAAGG - Intronic
1084415366 11:69029264-69029286 TTTAGGAAACAGAGGGAGGAGGG - Intergenic
1084965522 11:72742408-72742430 ATTAGGAAACAGCCTCAGAGAGG + Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1085604306 11:77883463-77883485 ATAAGGAAAAAGACTCAGAAAGG + Intronic
1086115603 11:83246181-83246203 ATCAGGAAAAAGAAATAGGATGG + Intronic
1086165690 11:83775163-83775185 ACAAGGAAATAGAGTTAGGAGGG - Intronic
1086810698 11:91306817-91306839 ATTAGAGGACAGAGTTAGGATGG + Intergenic
1087411514 11:97795907-97795929 ATAAGGAAACAGGCTTAGTGGGG + Intergenic
1088017893 11:105082149-105082171 ATAAGGAAACAACTTTAGGAAGG - Intronic
1091263413 11:134252206-134252228 ATTAGGAAACTAGGTTAGGAAGG - Intronic
1091371900 11:135067619-135067641 ATAAGGAAACAGACTCTGAAAGG + Intergenic
1093660188 12:21747719-21747741 ATTAGGAAACTCACTAAGAATGG + Intronic
1093937289 12:25014810-25014832 ATTAGGAAATAGACATAGGTTGG - Intergenic
1094582574 12:31748075-31748097 ATGAGGAAACAGACTTGGAGAGG - Intergenic
1095113266 12:38322094-38322116 ATTAGGAAACAGACATAGAATGG - Exonic
1095619329 12:44230169-44230191 ATAAGGAAACAGGCTTAGAGTGG + Intronic
1097495559 12:60327552-60327574 ATTAGAATATAGAATTAGGAGGG + Intergenic
1097653569 12:62333661-62333683 ATTAAGAAACAGATGTAGAATGG + Intronic
1097892317 12:64789956-64789978 ATTAGGAAACTGATTCAGAAAGG + Intronic
1098218941 12:68247672-68247694 ATTATGAAACACACATAGAAAGG - Intergenic
1098581392 12:72103376-72103398 ATTAGGAGACAGAGTTAATAAGG + Intronic
1098955608 12:76686753-76686775 TTTACTAAACAGACTTGGGAGGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100072399 12:90736615-90736637 ATTAGAAAAAAAATTTAGGAAGG + Intergenic
1100150959 12:91737057-91737079 ATGAGGAAACAGGTTTAGGGAGG - Intergenic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1101120448 12:101573968-101573990 CTTAGGAAACTGACTCTGGAAGG - Intronic
1101241114 12:102841100-102841122 ATGAGGAAACAGGCTTGGGAAGG + Intronic
1101452686 12:104794503-104794525 ATTTGAAAACAGACTTAAGCTGG - Intergenic
1101541138 12:105666548-105666570 ATGAGGAAACAGACATAGAAAGG + Intergenic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1102956243 12:117060938-117060960 ACGAGAAAACAGACTCAGGAAGG - Intronic
1103969330 12:124660190-124660212 ATTAGGAAAGAGAGACAGGAGGG + Intergenic
1105657399 13:22456072-22456094 GTTTGCAAACATACTTAGGAAGG - Intergenic
1105837968 13:24227041-24227063 AGTAGTTACCAGACTTAGGAAGG + Intronic
1106202905 13:27557284-27557306 ATGATGAAACAAACTTAGGGAGG + Intronic
1106829729 13:33566822-33566844 AATAGGAAACTGACTATGGAAGG - Intergenic
1108000784 13:45904105-45904127 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1108009268 13:45987340-45987362 ATTATTAAACATACTAAGGAAGG - Intronic
1108109179 13:47049308-47049330 AGTACGAAACAGACTTAAAAAGG - Intergenic
1109149414 13:58825597-58825619 ATTAGGAAAGAGAGCCAGGAGGG + Intergenic
1109432169 13:62250283-62250305 ATTAGGAAACAGAATAAAGTGGG + Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1109897923 13:68718759-68718781 ATTGGAAAACAGACTCAGGCAGG + Intergenic
1110037782 13:70711127-70711149 ATTAGGAAACAGAGAGATGATGG - Intergenic
1110061853 13:71051154-71051176 ATTAGGAAACAGAATTACATGGG - Intergenic
1110086036 13:71381036-71381058 ATTAAGAAACAGAATTAGCCAGG + Intergenic
1112456092 13:99565418-99565440 ATAAAGGAAAAGACTTAGGAGGG + Intergenic
1112504220 13:99965932-99965954 ATTAGGAAGAAGAATTAGGCTGG - Intronic
1112778957 13:102876800-102876822 AAAAGGACACAGACTTGGGAAGG - Intergenic
1112830772 13:103447595-103447617 ATTATCAAACAAACTGAGGAAGG - Intergenic
1115394558 14:32893519-32893541 ATTAGGAAAGTCACATAGGAAGG - Intergenic
1115420128 14:33184491-33184513 AGTAGGAGAGAGACTTGGGAAGG + Intronic
1115706426 14:36003512-36003534 ATGAGGAAACTGACTTACAAAGG - Intergenic
1116588969 14:46746724-46746746 AATAGGAAAAATACTTTGGATGG - Intergenic
1116699831 14:48226501-48226523 ATTAGGAAATATACTTAAAAAGG + Intergenic
1116711866 14:48378350-48378372 ATTAGGAAAAAAACCTTGGAGGG - Intergenic
1118634917 14:67739423-67739445 AGTAGGACACAGACTTAATAAGG - Intronic
1119613807 14:76085132-76085154 ATGAGGAAACAGACTCAGAGAGG + Intergenic
1119901235 14:78261708-78261730 TTTATGAAACTGACTTAGGGAGG + Intronic
1120785905 14:88535485-88535507 ATTAAGAAACAGACTCAGTGAGG - Intronic
1121434630 14:93910975-93910997 ATTAGGAAATAGACTTTATAGGG - Intergenic
1122045205 14:99018009-99018031 ATGAGGAAACAGGCTCAGCAAGG - Intergenic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1123926505 15:25117541-25117563 TATAGGAAACAGGCCTAGGATGG + Intergenic
1124232357 15:27956442-27956464 ATGAGGAAACAGACCTGGGGAGG - Intronic
1125233963 15:37490278-37490300 ATGAGGAGATAGAATTAGGAAGG + Intergenic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1126407619 15:48337433-48337455 ATGAGGAAACAGGCTCAGAAAGG - Intronic
1127854317 15:62942162-62942184 ATAAGGAAACAGACCTGGGAAGG + Intergenic
1127873685 15:63093994-63094016 ATGAGGAAACAGACTTAAAGAGG - Intergenic
1128451707 15:67809699-67809721 ATGAGGAAACAGACTCAGACAGG - Intergenic
1128576740 15:68781241-68781263 CTTAGCAAACAGACTGATGAGGG - Intronic
1129001549 15:72339376-72339398 ATAAGGAAACAAACATAGGAAGG - Intronic
1131864010 15:96687533-96687555 ATGAGGAAACAGGCTCAGGGAGG + Intergenic
1132001979 15:98189842-98189864 ATAGGGAAACAGACTTAGCAAGG + Intergenic
1133962133 16:10503687-10503709 TTGAGGAAACTGATTTAGGAAGG - Intergenic
1133985432 16:10664716-10664738 ATTAGGAAACAGATTCAGAAGGG + Intronic
1135629557 16:24025169-24025191 TTTAGGAAAATGACTTAGAAGGG - Intronic
1135926214 16:26696268-26696290 ATAAGAAAACAGACATAGGGAGG - Intergenic
1136997626 16:35201589-35201611 ATGAGGAAATAGTCTTAGGGAGG + Intergenic
1137024048 16:35455773-35455795 ATGAGGAAACAGTCTCAGGGAGG + Intergenic
1137543192 16:49378472-49378494 CTTAGGAAAGAGATTCAGGAAGG + Exonic
1138591568 16:58001865-58001887 ATCAGGAAACGGACCTAGGATGG - Intronic
1138710187 16:58962238-58962260 TTTAGGGAACAGACTAAAGATGG - Intergenic
1139002408 16:62528592-62528614 ACTATGAAACAGCCTTAGGCAGG - Intergenic
1139753489 16:69123789-69123811 ATTAGATAACAGACTTTGGCCGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140486170 16:75295363-75295385 ATTAGGAAACAGAACTAGCAAGG - Intronic
1140525747 16:75621454-75621476 ATGAGGAAACAGACCCAGCAAGG - Intronic
1140641204 16:76975612-76975634 ATTTGGAATCAGAATTTGGAAGG - Intergenic
1142858618 17:2747976-2747998 ATGAGGAGACAGGCTTAGAAAGG + Intergenic
1143392379 17:6567314-6567336 ATAAGGAAACAGGCTTAGAAAGG + Intergenic
1144038943 17:11391344-11391366 AGTAGGAAACAGAGCTAGAAAGG + Intronic
1144123262 17:12177575-12177597 CTTAAGAAACAGACTTAGTCAGG - Intergenic
1144185663 17:12792929-12792951 CTAAGGAAACAGACCAAGGAGGG - Intronic
1144966324 17:19078936-19078958 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1144981594 17:19173121-19173143 TTGAGGAAACAGACTCAGGGAGG - Intergenic
1144986630 17:19205118-19205140 TTGAGGAAACAGACTCAGGGAGG + Intergenic
1146448643 17:32953939-32953961 AGGAGGAAACAGGCCTAGGAAGG + Intergenic
1146986879 17:37228654-37228676 ATTAGGAAAGGGACTTAGGTAGG - Intronic
1147478889 17:40740160-40740182 ATTAGAAAATAGGGTTAGGACGG - Intergenic
1149508080 17:57212516-57212538 ATTTGGCTTCAGACTTAGGATGG + Intergenic
1149980669 17:61308757-61308779 GATAGAAAACAGACTTAGTATGG - Intronic
1150166903 17:62952623-62952645 ATTAGGAAATATATTGAGGATGG - Intergenic
1152036213 17:77874712-77874734 AAGAGGAAACAGGCTCAGGATGG - Intergenic
1152907767 17:82978259-82978281 ATTAGGAAGCAAACTGAGGAAGG - Intronic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153837546 18:8977449-8977471 GTCAGGAAAAAGACTTAGAAAGG + Intergenic
1153849773 18:9082338-9082360 AATAAGAAACAGACTAAGGGAGG - Intergenic
1154102250 18:11486938-11486960 ATAAAGAAACAAACTTATGACGG + Intergenic
1154327986 18:13405949-13405971 TTAAAGAAACGGACTTAGGAAGG - Intronic
1155615953 18:27721634-27721656 ATGAGAAAACAGCCTTAGGTGGG - Intergenic
1155639649 18:27998377-27998399 ATGAGGAAATGGGCTTAGGAAGG + Intronic
1156576413 18:38321724-38321746 ATTAGGCAAGAGACTTAAAAAGG + Intergenic
1158154139 18:54406421-54406443 TTGAGGAAACTGACCTAGGACGG + Intergenic
1159293707 18:66454211-66454233 ATTACAAATCAGAGTTAGGAGGG + Intergenic
1159816881 18:73085349-73085371 ATGAGGAAACAGACTTAAAAAGG + Intergenic
1160304096 18:77715909-77715931 CTTAGGAAACACACTTTGAAGGG - Intergenic
1162795999 19:13088066-13088088 ATTTGGAATCAGGCATAGGAAGG - Intronic
1162932529 19:13964083-13964105 AAAAGGAAACAGGCTTAGGGAGG - Intronic
1163288795 19:16365214-16365236 ATTAAGAAACAGGCTGAGGGGGG - Intronic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1166244719 19:41517226-41517248 ATTAGGAAACATACCAAAGAGGG + Intergenic
1166672688 19:44720855-44720877 TTTAGGAAGCAGAGGTAGGAGGG - Intergenic
1166830382 19:45635886-45635908 ATTAAGAAACAGACATAGCCCGG - Intronic
1166929640 19:46294362-46294384 ATTTGGATGCAGACTTAAGAAGG - Intergenic
1167023980 19:46900978-46901000 ATTACAAAGCAAACTTAGGAGGG - Intergenic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1167826843 19:51981266-51981288 ATTAGGCAAAAGAGATAGGAGGG - Intronic
925183630 2:1832519-1832541 TTTAGGAAACAGAATGAGCAGGG - Intronic
926110662 2:10181224-10181246 ATGAGGAAACAGGCTTAGAGTGG + Intronic
928513525 2:32023452-32023474 ATGAGGAAACAGACTTGGAGAGG - Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928680235 2:33693832-33693854 ATTGGGTAACAGGCATAGGATGG - Intergenic
928756503 2:34532083-34532105 ATTTTGAAAGAGACTTTGGAAGG - Intergenic
929769803 2:44882080-44882102 ATAAGGAAACAGACTCAGAGAGG - Intergenic
929902858 2:46020964-46020986 CTAAGGAAACAGACTCAGGGAGG + Intronic
930025001 2:47024460-47024482 ATAAGGAAACAAACTCAGGGAGG - Intronic
930352057 2:50269093-50269115 ATGGGGAAACAGACTTAGACAGG + Intronic
930884501 2:56309658-56309680 TTTAGAAAACAGTTTTAGGAAGG + Intronic
931020700 2:58041667-58041689 ATCAGGAAAAAGACTTGGAAAGG - Intronic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
933575036 2:84057582-84057604 TTTGGGAAACAGACTTTGTATGG - Intergenic
933651601 2:84854477-84854499 ATAAGAAAACAGACTCAGAAAGG + Intronic
933910073 2:86932046-86932068 TTTAGGAAACAGACTTGGAAGGG + Intronic
934022654 2:87971363-87971385 TTTAGGAAACAGACTTGGAAGGG - Intergenic
936182138 2:110276115-110276137 TTTAGAAAACAAACCTAGGAGGG + Intergenic
936230430 2:110695558-110695580 TTTAGAAAACAAACCTAGGAGGG - Intergenic
936413623 2:112283655-112283677 TTTAGGAAACAGACTTGGAAGGG + Intronic
937549181 2:123065662-123065684 ATGAGGAAACAGACCAAGAAAGG - Intergenic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
940475441 2:154156595-154156617 ATTAGGAAACATACTTAGAAAGG + Intronic
941023161 2:160431531-160431553 ATTATGAAACAGACTTTGGAAGG - Intronic
941473983 2:165925443-165925465 ATAAAGAAACAGCCTTAGTAAGG - Intronic
941848837 2:170158931-170158953 ATGAGAAAACTGGCTTAGGAAGG - Intergenic
942236834 2:173918633-173918655 AGAAGGAAAAAGACTTCGGAGGG - Exonic
942807872 2:179955310-179955332 TATAGGAAACAGACATATGAGGG + Intronic
943152362 2:184130643-184130665 ATAAGGAAATAGCCTTTGGATGG - Intergenic
943498973 2:188662432-188662454 ATTTGGATATATACTTAGGAGGG + Intergenic
944247068 2:197542047-197542069 ATTAGGAAACTGAATCAAGAAGG + Intronic
944669706 2:201984737-201984759 ATTAGGAAACAGGCCCAGCAAGG + Intergenic
945392404 2:209279946-209279968 ACTAGGAATCAGACCAAGGAAGG + Intergenic
945782660 2:214195699-214195721 AGTAGAAAACAGAATCAGGAGGG + Intronic
946148918 2:217751106-217751128 ATTACGATACAGACCTAGGAGGG + Intronic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1169055240 20:2615397-2615419 GTTAGGAAAGAGACAAAGGAAGG - Intronic
1169165601 20:3420939-3420961 ATAAGGAAACAGCCTCAGAAAGG + Intergenic
1170543261 20:17410196-17410218 ATAAGGAAACAGGCTCAGAAGGG + Intronic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1173671186 20:44800006-44800028 ATGAGGAAACAGGCTCAGGGAGG + Intronic
1173943281 20:46930375-46930397 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1174691439 20:52510389-52510411 ATTGGGAAATTGACTCAGGATGG - Intergenic
1175398333 20:58683597-58683619 ATTAAGAAAAAGACTTCGGCCGG + Intronic
1176028850 20:63000699-63000721 TTTATGAAACAGACTTTGGTTGG + Intergenic
1178884427 21:36474113-36474135 ATGAGGCAACAGTTTTAGGATGG + Intronic
1179553669 21:42159406-42159428 AGAAGGAAACAGACAAAGGAAGG + Intergenic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1181918653 22:26301704-26301726 AGTAGGAAATAGACTGAGGGTGG + Intronic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182553062 22:31111929-31111951 GTTAGGAAACAGGCTCAGAAAGG + Intronic
1183195681 22:36352006-36352028 ACTAGGAAACAGACTCAGAAAGG + Intronic
1183313480 22:37124386-37124408 ATTAGGAAACAGGCCCAGGGAGG - Intergenic
1185290714 22:50025723-50025745 AATAGGAAAAAGACTTAGTAAGG + Intronic
949535595 3:4993770-4993792 ATAAGGAAACAGATTCAGGAAGG - Intergenic
949687738 3:6596992-6597014 ATTAAAAAAAAGACATAGGAGGG - Intergenic
949934093 3:9103040-9103062 ATAAGCAAACACAATTAGGAAGG - Intronic
951638185 3:24803461-24803483 AAAAGGAAGCAGATTTAGGAGGG - Intergenic
952004278 3:28824412-28824434 ATTAGGAAAGAGCTGTAGGAAGG + Intergenic
952140494 3:30473567-30473589 ATGAGGAAACAGGCTAAGGGAGG - Intergenic
952421930 3:33140188-33140210 ATAAGGAAACAAACTCAGAAAGG + Intronic
952515728 3:34103361-34103383 ATGAGGAAACAGCCTCAGAAAGG - Intergenic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
953598765 3:44343206-44343228 ATGAGGAAACAGACTCCAGAAGG + Intronic
954773202 3:52992625-52992647 TTAAGGAAACATACTGAGGAAGG - Intronic
955123716 3:56088180-56088202 TTGAGGATCCAGACTTAGGAAGG - Intronic
956302239 3:67784831-67784853 ATGAGGAAACAGGCTTAGAAAGG + Intergenic
956601505 3:71027810-71027832 ATTAATAAACATACTTAGTAGGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956740719 3:72273669-72273691 TTTAAGAAACACAATTAGGAAGG + Intergenic
957042613 3:75348000-75348022 ATTATGGAACAGGCTTTGGAGGG - Intergenic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
960511516 3:118554808-118554830 ATTAAAAAAAAGACTTAGTAGGG - Intergenic
960675133 3:120186226-120186248 ATTAGGAAACAGACTTAGAGAGG + Intronic
961211229 3:125127580-125127602 ATTAGGAACAAGGCTTTGGAAGG + Intronic
961631815 3:128306785-128306807 ATGAGAAAACTGACTTAGGAAGG + Intronic
961933537 3:130558987-130559009 ATGAGGAAACAGACTTTTAAGGG - Intergenic
962086376 3:132196167-132196189 ATTAGAAAATAGACTTTTGATGG - Intronic
962932875 3:140053755-140053777 ATAATGAAACAGGCTTATGAAGG - Intronic
963041236 3:141071547-141071569 ATGAGGAAACTGTCTTGGGAAGG + Intronic
963270209 3:143279098-143279120 ATTAGTAAATTGACTTGGGATGG - Intronic
963871209 3:150415990-150416012 ATTAGGAAACAGATTTATTTGGG - Intronic
964514009 3:157486611-157486633 ATGAGGAAACAGACATAGAAAGG - Intronic
965983547 3:174723213-174723235 ATTAGGAAATAGGCTCAGAAAGG - Intronic
966266995 3:178058291-178058313 ATTTAGGAACAGACCTAGGAAGG + Intergenic
966299807 3:178465393-178465415 ATGAGGAAACATAATTAGAAAGG - Intronic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
970375350 4:15451513-15451535 TTTAGGAGAGGGACTTAGGAGGG - Intergenic
971165980 4:24184251-24184273 ATTAGGAAACTGACTTCTTAAGG + Intergenic
974882750 4:67779938-67779960 AATAAGAAACAGCCTTTGGAAGG - Intergenic
978323209 4:107521269-107521291 ATAAGGAAACAGTCTCAGGGAGG - Intergenic
979409193 4:120353860-120353882 CTTGAGAAACAGACATAGGAAGG - Intergenic
979548385 4:121962940-121962962 ATAAGGAAACAGACCCAGCAAGG - Intergenic
980996717 4:139786098-139786120 ATTTGGACACAGACATAGAAGGG + Intronic
981932918 4:150209667-150209689 ATTTGGAAACAGACACAGGATGG + Intronic
982316426 4:154036487-154036509 AGTAGGAAACTGAATTAAGATGG + Intergenic
982447973 4:155516914-155516936 ATTTAGAAACAGACTTTCGAAGG + Intergenic
983217344 4:165014112-165014134 ATTAGGAAACAAATATAGGCCGG - Intergenic
983809618 4:172043995-172044017 ATTAGGAAACAGTGTAAGGAAGG + Intronic
983906234 4:173184941-173184963 ATCAGGAACCTGACTTAAGAAGG - Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984943492 4:184953666-184953688 AATGGGAAACAGCCTTGGGAGGG + Intergenic
985166071 4:187095527-187095549 ATTAGAAAACATACTCAGGGTGG - Intergenic
986409743 5:7465308-7465330 ATGAGAAAAAAGACTCAGGAGGG - Intronic
987051149 5:14147212-14147234 ATGAGGAATCAGCCTTAGGGAGG + Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987637247 5:20559939-20559961 TTTAGGCAACAGACCTAGCAGGG - Intronic
988366264 5:30304212-30304234 ATTAGGAAATATACTGAGGAAGG - Intergenic
988729482 5:33956709-33956731 ATTAGGAAACAGAAGTCAGAAGG - Intronic
989346223 5:40432863-40432885 ATTAGGAAACAGAATTAAGGAGG - Intergenic
990773897 5:59283674-59283696 AGTAGGAAATATACTTAGCAGGG - Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
995207830 5:109502954-109502976 GGTAGGAAACAGCCTTAGGAAGG + Intergenic
995407402 5:111814719-111814741 ATAAGCAAAGAGACTTGGGAAGG + Intronic
995664049 5:114521464-114521486 ATTAGAAAAGACATTTAGGAGGG + Intergenic
995798463 5:115965048-115965070 ATGAGGAAACAGACTCAGAGAGG - Intronic
996632951 5:125659251-125659273 ACTAGGCAACAGACTGGGGAGGG + Intergenic
996708187 5:126518346-126518368 ATTAGGAAAAAGACCTAGAAAGG - Intergenic
997587404 5:135051646-135051668 ATTGGGATTCAGACTTAGGTTGG + Intronic
997685350 5:135784720-135784742 ATTAGGAAAAATACTATGGAGGG - Intergenic
998467974 5:142361091-142361113 AGTAGAAAACTGTCTTAGGAAGG - Intergenic
998774038 5:145578863-145578885 ATGAGTAAACAGAGTTAGAAGGG + Intronic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000380199 5:160622213-160622235 ATGAGGAAACAGACCCAGGGAGG + Intronic
1000718823 5:164680517-164680539 ATCAGGAAAAAGACATGGGAAGG + Intergenic
1000740153 5:164959165-164959187 ATAAGGAAACAGGCTTTGCAAGG - Intergenic
1001126814 5:169027051-169027073 ATGGGTAGACAGACTTAGGATGG + Intronic
1001399131 5:171436399-171436421 ATCAGGAAACAGACCCAGAAAGG - Intronic
1001975415 5:175994745-175994767 GCTGGGAAACAGACTCAGGAGGG + Intronic
1002242018 5:177849025-177849047 GCTGGGAAACAGACTCAGGAGGG - Intergenic
1003056151 6:2822374-2822396 ATTAGAAGACAGACTTAACATGG - Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004098998 6:12589354-12589376 ATGAGTAAAAAGACTTAGAAAGG + Intergenic
1004112636 6:12734522-12734544 ATTTGGACACAAACTCAGGAAGG + Intronic
1004150480 6:13114970-13114992 ATAAGAAAACAGCCTTAGGGAGG + Intronic
1007036848 6:38682211-38682233 ACTTGGGAACAGACTTAGGTAGG + Intronic
1007220072 6:40271822-40271844 AGTAGAAAACAGACTGAGAAAGG - Intergenic
1007303604 6:40887366-40887388 ATGAGGAAACAGACTTTGAGAGG - Intergenic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010756763 6:79674053-79674075 CTTTGGAAACAGAAGTAGGAAGG + Intronic
1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG + Intergenic
1011021514 6:82818669-82818691 AATAGGACAAAAACTTAGGAGGG + Intergenic
1013418547 6:109946060-109946082 AGTAGGAAAAAGACTCAGGTGGG + Intergenic
1014104117 6:117543846-117543868 ATAAGGAAACAGGCTTGGGGAGG - Intronic
1014551736 6:122796901-122796923 ATTTGGAAAGAGACTCTGGATGG - Exonic
1015170195 6:130243552-130243574 GTTAAGAAACAGGCTTAGCAAGG + Intronic
1015619986 6:135121248-135121270 AAAAGGAAACAGACAGAGGAAGG + Intergenic
1016394721 6:143611406-143611428 ATTTGGAGCCAGACTGAGGAAGG + Intronic
1016513373 6:144867961-144867983 ATCAGGAAAAAGACTTGGAAAGG + Intergenic
1017651329 6:156585757-156585779 ATTAGGTAACATAATCAGGAAGG - Intergenic
1018074581 6:160200603-160200625 AATGAGAAACAGACCTAGGAAGG - Intronic
1018741304 6:166731266-166731288 ATTGGAAAACACACTTTGGATGG - Intronic
1018925060 6:168200078-168200100 ATCAGGAAAAAGACTTGGAAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021908504 7:25360661-25360683 TTAAGAAAACACACTTAGGAAGG + Intergenic
1021925090 7:25526606-25526628 ATGAGGAAACAAACTAAAGATGG + Intergenic
1023034333 7:36117485-36117507 ATTAGGAGAGAGAATTAGGCAGG + Intergenic
1023119628 7:36896229-36896251 ATAAGGAAACCGACTGAGAAAGG + Intronic
1025246147 7:57319063-57319085 ATAAGGAAACAGATTTAGAGTGG - Intergenic
1026537772 7:71254348-71254370 ATCAGGAAAAAGACCTGGGAAGG + Intronic
1027597457 7:80192535-80192557 ATAAGGAAACAAGCTTAGGGAGG - Intronic
1028102353 7:86836832-86836854 ATTAGGAAACAGAGTCAGAAAGG + Intronic
1028385512 7:90248850-90248872 ATGAGGAAACAGACACAGAAAGG - Intronic
1028457624 7:91055923-91055945 ATTAGGTTACAAACTTAGGAAGG - Intronic
1029043167 7:97598778-97598800 ATGAGGAAACAGACTTACAGAGG - Intergenic
1029724077 7:102390730-102390752 ATAAGGAAACAGCCTTAGAGAGG + Intronic
1031405427 7:121379960-121379982 AATAGGAAGCAGATTTTGGAGGG - Intronic
1031431694 7:121678486-121678508 ATTAGGAAAAATACTTTGCAAGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032821490 7:135528205-135528227 TTTAGGAAACAGAGATAGCATGG - Intergenic
1033179742 7:139164320-139164342 ATGAGGAAACAGGCTCAGAAAGG + Intronic
1033734778 7:144211059-144211081 ACTAAAAAACAGACTCAGGATGG - Intergenic
1034087878 7:148337008-148337030 ATTAGGCAACATATATAGGAAGG + Intronic
1034330664 7:150279563-150279585 AGTGGGAAACAAACCTAGGAGGG - Intronic
1034667378 7:152830286-152830308 AGTGGGAAACAAACCTAGGAGGG + Intronic
1035226968 7:157439049-157439071 TTTAGGACACAGGCTGAGGAGGG - Intergenic
1036770197 8:11573410-11573432 GTGAGGAAACAGGCTTAGGGAGG - Intergenic
1036775500 8:11609082-11609104 AAGAGGAAACAGACTTAGATGGG + Intergenic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1039931246 8:41991715-41991737 CTTAGGAAACAGGCTGAAGATGG + Intronic
1040624554 8:49132045-49132067 ATTAGCAATGAGACTTAGAATGG - Intergenic
1042917663 8:73891201-73891223 ATAAGGAAACAGGCTTAGAGAGG + Intergenic
1043670246 8:82875565-82875587 TTTAGGAAACAGAAGTAAGAAGG + Intergenic
1044059733 8:87621038-87621060 TTTAGTAAACATATTTAGGAAGG - Intergenic
1044358304 8:91251970-91251992 AATAGGATACAGAGTAAGGAAGG + Intronic
1044481206 8:92691052-92691074 ATTATGAAACAGGCTAAGCAAGG - Intergenic
1045295198 8:100866445-100866467 ATTGGGAAACAGACCTATTAGGG - Intergenic
1045905909 8:107344079-107344101 ATAAGGAAATAAACATAGGATGG + Intronic
1046691786 8:117293822-117293844 ATTGGGATAAAGACTTTGGATGG + Intergenic
1048470383 8:134699452-134699474 ATTAGGAAACGGGCTCAGCAGGG - Intronic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1050284075 9:4082831-4082853 CTTTCGAAACAGACTTAAGATGG + Intronic
1050714946 9:8512993-8513015 ATTAGAAAACACATTCAGGAAGG - Intronic
1051093151 9:13433880-13433902 ATAAGGACACATATTTAGGAAGG - Intergenic
1052472385 9:28916324-28916346 ATCAGGAAAAAGACCTAGAAAGG - Intergenic
1052629598 9:31020090-31020112 ATAAGGAAACAGACTTCAGATGG + Intergenic
1054866909 9:70012287-70012309 ATAAGGAAACAGACCTAGAAAGG + Intergenic
1055222915 9:73959594-73959616 AGTAGAAAACAAACTTAGGTTGG - Intergenic
1056492266 9:87119628-87119650 AGAAGTAAACAGACTTAGCAAGG + Intergenic
1057841837 9:98492327-98492349 ACTAGGAAACAAACTTAAGCGGG - Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1059206331 9:112469782-112469804 ATGAGGAAACAGACTCAAAAAGG - Intronic
1060032961 9:120231587-120231609 ATTATGAAGCAGACATTGGAAGG + Intergenic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1060872700 9:127055599-127055621 ATGAGGAAACAGACACAGAAAGG + Intronic
1060916532 9:127395166-127395188 ATAAGGAAATAGGCTTAGGAAGG + Intergenic
1061030334 9:128078123-128078145 ATAAGGAAACAGACTTGGAGAGG - Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1062667672 9:137685184-137685206 TTTTGGAAACAGACTGATGACGG - Intronic
1187862601 X:23696583-23696605 ATGAGGAAACAGGCTTAGAGAGG - Intergenic
1188611686 X:32107192-32107214 ATTAGGAAAAAGAGCCAGGATGG + Intronic
1188659827 X:32745076-32745098 ATTTTGAAACAAACTTAGCAAGG - Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189755749 X:44269802-44269824 AAAAGGAAACAGGCTTAGGGAGG - Intronic
1189806959 X:44744846-44744868 ATTAAGAGACAGAGTTAAGAAGG + Intergenic
1190935426 X:54995003-54995025 ATTAGGATGGAGATTTAGGAGGG + Intronic
1191797141 X:65033767-65033789 ATAAGGAAACAGATTTAGACAGG + Intronic
1191845534 X:65544886-65544908 TTGAGGAAACAGACTTAGAAGGG - Intergenic
1192627453 X:72745094-72745116 ATAAGAAAACAGGCTTAGAAAGG - Intergenic
1192654255 X:72975719-72975741 ATAAGAAAACAGGCTTAGAAAGG + Intergenic
1192774143 X:74224083-74224105 ATTAGGAAAATGACATAGTAAGG - Intergenic
1193639827 X:83999568-83999590 ATTAGGAAATAAATTTAGTAGGG - Intergenic
1193824533 X:86206664-86206686 ATGAGGAAAGAGATTTAGCAAGG - Intronic
1196007899 X:110854951-110854973 ATAAGGAAACAGGCTTAGAGAGG - Intergenic
1196047714 X:111273691-111273713 ATCAGGGAAGAGACTGAGGATGG + Intergenic
1196124724 X:112085060-112085082 ATTAGAAAGCTGACTTAGGCAGG + Intergenic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1198295864 X:135285703-135285725 ATTTGGAAACAGGCTTAGAACGG + Intronic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1200391233 X:155948997-155949019 ATTAGGACAGGGGCTTAGGATGG + Intergenic