ID: 931602652

View in Genome Browser
Species Human (GRCh38)
Location 2:64019415-64019437
Sequence CCGCGCGGTGGATTGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931602652_931602663 -5 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602663 2:64019433-64019455 CGCGGCTCCGCCGGGGCGGGAGG No data
931602652_931602673 15 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602673 2:64019453-64019475 AGGGCCGCGGCCCGGGCCGGGGG No data
931602652_931602662 -8 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602662 2:64019430-64019452 CCGCGCGGCTCCGCCGGGGCGGG No data
931602652_931602660 -9 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602660 2:64019429-64019451 ACCGCGCGGCTCCGCCGGGGCGG No data
931602652_931602672 14 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602672 2:64019452-64019474 GAGGGCCGCGGCCCGGGCCGGGG No data
931602652_931602666 2 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602666 2:64019440-64019462 CCGCCGGGGCGGGAGGGCCGCGG No data
931602652_931602668 7 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602668 2:64019445-64019467 GGGGCGGGAGGGCCGCGGCCCGG No data
931602652_931602664 -4 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602664 2:64019434-64019456 GCGGCTCCGCCGGGGCGGGAGGG No data
931602652_931602674 16 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602674 2:64019454-64019476 GGGCCGCGGCCCGGGCCGGGGGG No data
931602652_931602669 8 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602669 2:64019446-64019468 GGGCGGGAGGGCCGCGGCCCGGG No data
931602652_931602671 13 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602671 2:64019451-64019473 GGAGGGCCGCGGCCCGGGCCGGG No data
931602652_931602670 12 Left 931602652 2:64019415-64019437 CCAGCCCACAATCCACCGCGCGG No data
Right 931602670 2:64019450-64019472 GGGAGGGCCGCGGCCCGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931602652 Original CRISPR CCGCGCGGTGGATTGTGGGC TGG (reversed) Intergenic