ID: 931605525

View in Genome Browser
Species Human (GRCh38)
Location 2:64048776-64048798
Sequence GGTTGATTAACCTACCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931605522_931605525 1 Left 931605522 2:64048752-64048774 CCTGTTGTAATAGTCAATCTTCC No data
Right 931605525 2:64048776-64048798 GGTTGATTAACCTACCAGAGAGG No data
931605521_931605525 19 Left 931605521 2:64048734-64048756 CCACTTCTAATCTTCTGTCCTGT No data
Right 931605525 2:64048776-64048798 GGTTGATTAACCTACCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931605525 Original CRISPR GGTTGATTAACCTACCAGAG AGG Intergenic
No off target data available for this crispr