ID: 931612453

View in Genome Browser
Species Human (GRCh38)
Location 2:64116995-64117017
Sequence CCTTATATGGACACAATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931612453_931612459 8 Left 931612453 2:64116995-64117017 CCCTGAATTGTGTCCATATAAGG 0: 1
1: 0
2: 5
3: 55
4: 225
Right 931612459 2:64117026-64117048 TTAATTGATAAATGCTGAGTGGG 0: 1
1: 0
2: 4
3: 20
4: 241
931612453_931612458 7 Left 931612453 2:64116995-64117017 CCCTGAATTGTGTCCATATAAGG 0: 1
1: 0
2: 5
3: 55
4: 225
Right 931612458 2:64117025-64117047 CTTAATTGATAAATGCTGAGTGG 0: 1
1: 0
2: 1
3: 15
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931612453 Original CRISPR CCTTATATGGACACAATTCA GGG (reversed) Intronic
900983123 1:6057848-6057870 CCTTATAAGAACACCAGTCATGG + Intronic
904848066 1:33435728-33435750 TCTTATAAGGACACCAGTCATGG + Intergenic
906760291 1:48371040-48371062 CCATATATGGCCACAATTGAGGG - Intronic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
909220357 1:72951435-72951457 TCTTATATGGCCACAGTTCATGG + Intergenic
909267319 1:73577220-73577242 CCATTTCTGGACACAAATCATGG + Intergenic
909771154 1:79423391-79423413 CTTTATATGGAAATAATGCACGG + Intergenic
909851198 1:80466430-80466452 CCTTTTATTGACTCATTTCATGG - Intergenic
910015292 1:82516542-82516564 CCTAAGATAGACACAATTCTGGG + Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
918392092 1:184076343-184076365 TCTTATATGGGCACAATTTGTGG - Intergenic
918678967 1:187327246-187327268 CCTTATATGTGAACAATTTAAGG + Intergenic
919027081 1:192186626-192186648 CCTTACTTGGATACAAGTCAAGG - Intergenic
920538364 1:206757409-206757431 TCTTATATGGACACAGTTTGTGG + Intergenic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
920882609 1:209894499-209894521 CCTAATATGTACATTATTCAAGG - Intergenic
922032454 1:221814776-221814798 TCTTATATGGACTCACTTCATGG - Intergenic
922181262 1:223234719-223234741 CCTAAAATGGACACAAATCCTGG - Intronic
922823427 1:228500815-228500837 CCTTGTATGGACGCAGTTCTTGG + Intergenic
924499861 1:244627216-244627238 TCTTATATGGTCGCAGTTCATGG + Intronic
1063247054 10:4232069-4232091 TCTCATATGGGCACAGTTCATGG - Intergenic
1063329483 10:5142692-5142714 TCTTATATGGGCACAGTTTAGGG + Intergenic
1064191920 10:13214089-13214111 ACTTATATGGGCACAGTTCCTGG - Intergenic
1064478525 10:15717677-15717699 CCTAATTTGGTCATAATTCAAGG + Intronic
1068276487 10:54805543-54805565 CCTTTTATTGTCAGAATTCAAGG + Intronic
1069480833 10:68780801-68780823 TCTTCTATGGGCACAATTCAAGG - Intronic
1071201169 10:83221824-83221846 CCTTAGATGGACACCACACACGG + Intergenic
1071222055 10:83478965-83478987 TCTTGTATGGGCACAATTCATGG - Intergenic
1072580825 10:96738991-96739013 TCTTATATGGGCACAGTTCTGGG - Intergenic
1074245777 10:111690537-111690559 CCTTAAATGTACACAAATAATGG + Intergenic
1074306124 10:112280139-112280161 CCTCAGATGAACACACTTCAGGG + Intergenic
1074540904 10:114364558-114364580 TCTTATAAGGACACCAGTCACGG + Intronic
1075144883 10:119873989-119874011 TCTTATATGGGCAAAACTCAAGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1076202590 10:128570296-128570318 CCCAAAATGAACACAATTCATGG - Intergenic
1076822161 10:132944805-132944827 TCTTATATGGACACCAGCCATGG + Intergenic
1079903594 11:26219129-26219151 CTTTTTTTGGTCACAATTCATGG - Intergenic
1080202266 11:29686165-29686187 CCTTAAATGGATTCAATTCAAGG + Intergenic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1081279882 11:41196051-41196073 GCTTATTTGGACACAATAGAAGG + Intronic
1081485743 11:43526853-43526875 TCTTATATGGGCACAGTTCGTGG + Intergenic
1082130500 11:48482947-48482969 CCTTATAAGCACACTAATCATGG - Intergenic
1082686703 11:56246721-56246743 TCCTATATGGGCACAGTTCATGG + Intergenic
1083135178 11:60666885-60666907 TCTTATATAGACACAGTTTATGG - Intergenic
1083135193 11:60667146-60667168 TCTTATATAGACACAGTTTATGG - Intergenic
1083164264 11:60873859-60873881 ACTTATATGGACAAAGTTCTGGG + Intronic
1083167006 11:60895910-60895932 ACTTTTATGGGCACATTTCATGG + Intronic
1084137710 11:67199123-67199145 TCCTATATGGATACAGTTCATGG - Intronic
1084358755 11:68656240-68656262 TCTTAGAAGGACACAAGTCATGG - Intergenic
1084668161 11:70588045-70588067 TCTTATATGGGTACAGTTCATGG - Intronic
1087156054 11:94905152-94905174 CCTTTAATGGACACAGTTCATGG + Intergenic
1089187623 11:116630685-116630707 TCTTATATGGACACCAGTCATGG + Intergenic
1093215067 12:16352369-16352391 GCTAATAAGGACACAATGCAGGG + Intronic
1093691166 12:22110818-22110840 TCTTACATGGGCACATTTCATGG + Intronic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1095688130 12:45058966-45058988 TCTTATATGGGCACAGTTCTTGG + Intergenic
1095920016 12:47519680-47519702 TGTAATATGGGCACAATTCAGGG - Intergenic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097973246 12:65657681-65657703 CCCTCTGTGGAAACAATTCAGGG - Intergenic
1098719599 12:73880179-73880201 CCATATATGGAAATAATTCTGGG + Intergenic
1101226117 12:102689731-102689753 TATTATATGGACATAAGTCATGG + Intergenic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1107898026 13:44985659-44985681 TCTTATATGGCCACGATTCATGG - Intronic
1108337013 13:49453888-49453910 ACTTATATATACACAACTCATGG + Intronic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1110285645 13:73747219-73747241 CCTTACATGCACACAATTGAGGG + Intronic
1110746240 13:79056836-79056858 TCTTGTATGGGCACAATTCATGG - Intergenic
1111365963 13:87245512-87245534 TCTTATATGGGCAGAATTTATGG - Intergenic
1113061202 13:106324166-106324188 CCTTATAAGGACACAAGTCATGG + Intergenic
1114950053 14:27739041-27739063 TCTCATATGGGCACTATTCATGG - Intergenic
1114980909 14:28162785-28162807 CCACATATGAACACAATTAATGG + Intergenic
1115109997 14:29810099-29810121 TCTTATATGGGCACAATTTTTGG + Intronic
1115308226 14:31953742-31953764 TCTTATATGGATGCAATTCATGG - Intergenic
1115740789 14:36385713-36385735 TTTTATATGGGCACAGTTCATGG - Intergenic
1116611105 14:47073198-47073220 CCTGATATGGTCATAATTTAAGG + Intronic
1117231239 14:53720975-53720997 TCTTATATGGGCACAGTTCGTGG - Intergenic
1118013220 14:61631456-61631478 CGTTTTATGGACACAAGGCAGGG - Intronic
1118518062 14:66548505-66548527 TATTATATGGACACAGTTCATGG - Intronic
1119622547 14:76142606-76142628 TCTTACATGGTCACAACTCATGG + Intergenic
1120174986 14:81284025-81284047 TCTTATATGGGCACAGTTTATGG - Intronic
1120281030 14:82438052-82438074 CCTTAGATGTACTCAATTCTAGG - Intergenic
1121336747 14:93082362-93082384 GCTTAGATGAACACAATTCGGGG + Intronic
1121461458 14:94081747-94081769 TCTTATATGGGCACAGCTCATGG - Intronic
1122054551 14:99084780-99084802 TCTCATCTGGACACACTTCATGG + Intergenic
1124367687 15:29085162-29085184 TCTTATATGAACAATATTCAGGG - Intronic
1124397157 15:29312646-29312668 CCTTATATGGGCACAGTTCATGG - Intronic
1126939348 15:53749380-53749402 TCTTATATGGGCATAATTTATGG - Intronic
1127447136 15:59075028-59075050 TCTTATATGGGCACAGTTCTTGG + Intronic
1128189954 15:65682928-65682950 TCTTATATGGGAACAGTTCATGG + Intronic
1130752850 15:86731129-86731151 CCTTATATATAAACAAATCAGGG + Intronic
1131974168 15:97926102-97926124 TATTATAGGGACACAGTTCATGG + Intergenic
1136397635 16:30001693-30001715 GCTTGTATGGAGACAAATCAGGG + Intronic
1136670983 16:31857159-31857181 CCTGATATGAAAACAATACAAGG + Intergenic
1138892334 16:61159128-61159150 CCTTATTTAGATACAAGTCATGG - Intergenic
1142836649 17:2592947-2592969 CCTTATAGGGATACAGTTCCAGG + Intergenic
1143076396 17:4347859-4347881 TCTCATATGGGCACAATTCGTGG - Intronic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146158361 17:30543783-30543805 TCTTAGATGGGCACAGTTCATGG - Intergenic
1153181534 18:2440738-2440760 TCTTATATGGATGCAGTTCATGG + Intergenic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153491258 18:5650527-5650549 TCTTATATGGATGCAGTTCATGG - Intergenic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154220123 18:12445264-12445286 TCTTATATGGGCACAGGTCATGG + Intergenic
1154279458 18:12990050-12990072 CCTTATTTTGACGCATTTCATGG - Intergenic
1155376293 18:25161407-25161429 CTTTTTATGGACACAATGGAGGG + Intronic
1155772617 18:29721550-29721572 CTTCATATGCAGACAATTCATGG - Intergenic
1156768835 18:40694649-40694671 GCTTAAATGAACAGAATTCAAGG + Intergenic
1156775847 18:40787635-40787657 CCGTATATGGACACTATACTGGG + Intergenic
1158581651 18:58689513-58689535 CCATATGTGGGCACAATTCTAGG + Intronic
1158816669 18:61106103-61106125 ACTTCTATGGGCACAGTTCATGG + Intergenic
1159254602 18:65930484-65930506 GCTTACTTGGACAAAATTCATGG - Intergenic
1160099903 18:75910636-75910658 CTTTCTATGGCCATAATTCAAGG + Intergenic
1167750005 19:51373624-51373646 GATTATGGGGACACAATTCAAGG - Intergenic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
926818585 2:16827118-16827140 TCTTGTATGGGCACAGTTCATGG + Intergenic
928194540 2:29205812-29205834 CCTTATAAGGCAACAATTCTGGG + Intronic
929182188 2:39053483-39053505 CTTTAAATGGACACACTGCATGG - Intronic
929338168 2:40777789-40777811 CTTTATATGGGCACAATCCATGG + Intergenic
930330647 2:49978942-49978964 CCTGATATTGACAAATTTCAAGG + Intronic
931053399 2:58439577-58439599 CCTTATTTGGATACATTTAAAGG + Intergenic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
932482212 2:72050913-72050935 CATGATATGGCCACAAGTCAAGG + Intergenic
932655367 2:73606779-73606801 CCTTAATAGGACACAATTGAAGG - Intronic
933462448 2:82605813-82605835 TCATATATGCACACACTTCAAGG - Intergenic
937626982 2:124054948-124054970 TCTGTTAGGGACACAATTCATGG - Intronic
938396349 2:130951536-130951558 TCTTCTATGGGCACAGTTCATGG + Intronic
938960617 2:136337322-136337344 TCTTATATGAGCACAGTTCATGG - Intergenic
940024007 2:149185895-149185917 CCTTATATGGGTATATTTCATGG - Intronic
940448054 2:153801558-153801580 TCTTGTATGGCCACAATTCATGG + Intergenic
943083905 2:183289169-183289191 TCTTTTATAGGCACAATTCATGG - Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
945189317 2:207169809-207169831 TCTTATTTGGGCACAGTTCATGG - Intergenic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
947639619 2:231699666-231699688 CCGTAAATGACCACAATTCAAGG + Intergenic
947786297 2:232824034-232824056 CCTTACATGGGCACAGTTCACGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170812219 20:19683371-19683393 CTGTATATGCACACAGTTCAAGG - Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1176951183 21:15048092-15048114 GCTGATATGGGCACAGTTCATGG + Intronic
1178352246 21:31880590-31880612 CTTTATAAGGACACCAGTCATGG + Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1181718444 22:24753561-24753583 CCTTACAGGGACACAATTTGAGG - Intronic
1182353698 22:29712736-29712758 CCTTTTATGAACTCAATCCAAGG + Intergenic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
951042969 3:18008527-18008549 TCTTATGTGGACACAGCTCATGG + Intronic
951500518 3:23381618-23381640 CCTAATATTAACATAATTCAGGG - Intronic
955524822 3:59809250-59809272 CCTTATAAGGACACCAGTCACGG - Intronic
956788990 3:72666113-72666135 CCTTCTATTGACACAATAGAAGG + Intergenic
958176693 3:90004426-90004448 TCTTATATGCACCCAATTTAAGG + Intergenic
959396730 3:105849550-105849572 GCTTATGTGGAAACATTTCATGG - Intronic
959611882 3:108304424-108304446 ACTTATATTGACACAAGACAAGG - Intronic
960097992 3:113706634-113706656 TCTTATATGGGCACAATTTGTGG + Intergenic
961492813 3:127266991-127267013 CATTACATGGACACAAGTCAGGG + Intergenic
963550005 3:146708002-146708024 TCTTATATAGGCACAGTTCATGG + Intergenic
963584507 3:147167557-147167579 TCTTATGTGGGCACAATTCATGG + Intergenic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964870389 3:161307453-161307475 TCTTATACGGTCACAGTTCATGG - Intergenic
964942165 3:162171972-162171994 CCTTATATGGGCCTGATTCATGG - Intergenic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
967327919 3:188260625-188260647 CCTTATATTTACACAATGCTTGG + Intronic
969901171 4:10351098-10351120 TCTTATATGGAGAAAATTTAAGG - Intergenic
970528774 4:16960637-16960659 CCTTATATGGGTGCAGTTCATGG - Intergenic
971007742 4:22393841-22393863 AATTGAATGGACACAATTCATGG + Intronic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
975266114 4:72369946-72369968 CTTTATATGGACACAAATAATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975695501 4:77008820-77008842 ATTGATATGGCCACAATTCAGGG + Intronic
977194459 4:94042253-94042275 TCCTGTATGGACAGAATTCATGG + Intergenic
977225826 4:94390425-94390447 TCTTATAAGGGCACAGTTCATGG + Intergenic
977546920 4:98394466-98394488 CCTTATATGGACATACTACATGG - Intronic
978308728 4:107361966-107361988 TCTTATAAGGGCACAGTTCATGG + Intergenic
978469931 4:109054214-109054236 CCTTATAATTACACTATTCAAGG + Intronic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979973817 4:127170791-127170813 TCTTATGTGGACACAATTCATGG - Intergenic
980546579 4:134271221-134271243 CTTTATATGGTCACAGTTCATGG - Intergenic
982017647 4:151171174-151171196 GCTCATGTGTACACAATTCAAGG - Intronic
983154767 4:164333530-164333552 TCTTATGTGGGCACAGTTCATGG - Intronic
984299355 4:177895098-177895120 TCTTATATGGGCACAATTTGTGG - Intronic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984461079 4:180037612-180037634 TCTTATATGGTCACAGTTCTTGG - Intergenic
984545187 4:181092862-181092884 TCTTATATGGAAGCAGTTCATGG + Intergenic
984822947 4:183899125-183899147 TCTTATATGGGCACACTTCGTGG - Intronic
985021289 4:185693458-185693480 CCTTAAATGGACAAAATAAATGG + Intronic
985311108 4:188600505-188600527 TCTTATATGAGCACAATTCATGG + Intergenic
986293888 5:6421713-6421735 TCTTATAAGGACACCAGTCATGG - Intergenic
986383835 5:7211545-7211567 TCTTAGAAGGACACCATTCATGG + Intergenic
986792692 5:11179078-11179100 TCTTGGATGGACACATTTCAAGG + Intronic
987263686 5:16229295-16229317 CCTTATAATGACACTAGTCATGG + Intergenic
987279923 5:16402569-16402591 TCTTATATGGGCACCATTTATGG + Intergenic
987668313 5:20974711-20974733 TCTTATCTGTTCACAATTCAAGG - Intergenic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
988304784 5:29480659-29480681 CCTTTCATGGACACAAATCATGG + Intergenic
988694136 5:33602644-33602666 CAGTATATGGTCACAAATCAGGG + Intronic
989532370 5:42523535-42523557 CCTTATATGGGTGCAATTCATGG - Intronic
993619026 5:90146566-90146588 GTTTATGTGAACACAATTCATGG - Intergenic
994476082 5:100271927-100271949 TCTTATATGGACACAGCTCGTGG - Intergenic
994578110 5:101607540-101607562 TTTTTTATAGACACAATTCAAGG - Intergenic
995208437 5:109509303-109509325 CCTTCTATGAACATACTTCATGG - Intergenic
997176201 5:131780684-131780706 TCTTATATGGGCACAGTTCCTGG - Intronic
997650346 5:135512976-135512998 CCTTGTATGGGCCCAATTAAGGG - Intergenic
997863698 5:137442808-137442830 CCTTTTCTGGCCACAATTCACGG + Intronic
998407831 5:141883783-141883805 CCCTATCTGGGCACAATTGAAGG + Intergenic
998635744 5:143953003-143953025 CCTCATGTGCACACAATCCAAGG - Intergenic
1001827503 5:174757444-174757466 GCTTATGTTAACACAATTCAAGG + Intergenic
1001901703 5:175436379-175436401 CCTCATATGCACATAATTTAGGG + Intergenic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003946863 6:11084053-11084075 TCTTATAAGGACACTAGTCATGG - Intergenic
1004924899 6:20406657-20406679 CCTTGAATTGTCACAATTCAAGG - Intronic
1009379991 6:63015996-63016018 TCTTATATGGGCACATTTCTTGG - Intergenic
1011644614 6:89445921-89445943 TCTTATTTGGGCACAATTCATGG - Intronic
1012084144 6:94802030-94802052 TCTCATATGGACACAGTTCTTGG - Intergenic
1012111730 6:95243739-95243761 ACTCATATGCACACATTTCATGG + Intergenic
1012667324 6:101989577-101989599 TCTCATATGGACAAAATCCATGG - Intronic
1013712832 6:112921438-112921460 TCTTATACGGGCACAGTTCATGG - Intergenic
1013802298 6:113961628-113961650 CCTTACATGGTGACAATACAAGG + Intronic
1013811992 6:114055379-114055401 CCTTATATTGACTTCATTCATGG + Intergenic
1014419197 6:121219940-121219962 TCTTATCTGGATACAGTTCATGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015530335 6:134215471-134215493 CATTAACTGGAAACAATTCATGG - Intronic
1016199424 6:141389561-141389583 TCTTATATGAGCACAGTTCATGG + Intergenic
1018224142 6:161611558-161611580 TCTTATGTGGGCACATTTCATGG - Intronic
1018624855 6:165767313-165767335 CTTTAAAAGTACACAATTCAGGG + Intronic
1019042606 6:169119209-169119231 CCTTAGATGGACACCATCCGTGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020113645 7:5462533-5462555 CCTCATTTGGCCACAATCCATGG - Intronic
1020369145 7:7413937-7413959 CCTTATATAAACACAATTCCTGG - Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1021733055 7:23615805-23615827 TCTTATATAGATAGAATTCAAGG + Intronic
1024098924 7:46008958-46008980 CATTGTATGCACTCAATTCATGG + Intergenic
1027617866 7:80446094-80446116 CTTTTTTTGTACACAATTCATGG - Intronic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1030184679 7:106750159-106750181 CCTTATATGGGCAGAACTCCAGG - Intergenic
1030749071 7:113207309-113207331 CCTTGTCTGGACACAGTTCAGGG - Intergenic
1030952951 7:115814916-115814938 CCATATAATAACACAATTCATGG - Intergenic
1031252002 7:119395964-119395986 CCATATATGTGCACAATGCAGGG + Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033139025 7:138808719-138808741 CCTTAAATGTAGACAATTAAGGG - Intronic
1033241589 7:139684172-139684194 TCTTATATGGGTGCAATTCATGG - Intronic
1033393845 7:140955384-140955406 TCTTATATGGGCGCAGTTCATGG - Intergenic
1036198027 8:6738421-6738443 TCTTATATGGGTGCAATTCATGG + Intronic
1037218554 8:16488026-16488048 TCTTATATGGGTACAGTTCATGG + Intronic
1037447696 8:18983656-18983678 TCTTACATGGACACAGTTCTTGG + Intronic
1037721502 8:21448286-21448308 CCTTATAAGGACACCAGTCATGG - Intergenic
1040076079 8:43232496-43232518 TCTTCTATGGGCACAGTTCATGG + Intergenic
1040122588 8:43699573-43699595 ATTTGTATGGACACTATTCAAGG - Intergenic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1040793954 8:51268992-51269014 CCATATATTGGCACCATTCAGGG + Intergenic
1041691305 8:60690630-60690652 ATTAATAAGGACACAATTCAAGG + Intronic
1041788331 8:61660666-61660688 CCTTACATGGACAAAAATCATGG - Intronic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1042785782 8:72545491-72545513 TCTTATATGGGCACAACTCGTGG - Intronic
1043173144 8:76990669-76990691 TCTTATATGGATACAGTTCTTGG + Intronic
1043173150 8:76990719-76990741 TCTTATATGGATACAGTTCGTGG + Intronic
1043944771 8:86237604-86237626 TCTTATATGGGCACAGATCATGG + Intronic
1046654658 8:116880048-116880070 CATTTTAAGGACAAAATTCAAGG + Intergenic
1049314175 8:141951189-141951211 TCTTTCATGGGCACAATTCATGG - Intergenic
1049852100 8:144838225-144838247 CCTTAGAAGGACACCAGTCATGG + Intronic
1051526326 9:18049101-18049123 TCTTATAAGGACACCAGTCATGG + Intergenic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1052454227 9:28673827-28673849 ACTTTAATCGACACAATTCAAGG + Intergenic
1054863600 9:69977431-69977453 CCTTATTTGGAGATAATTCTTGG - Intergenic
1058137217 9:101320211-101320233 CCTCATATGGATACAATTTGAGG + Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1062311354 9:135939242-135939264 CCTTATATGTACATATTTTATGG - Intronic
1186027525 X:5329166-5329188 CCTTATGTGGACAAAGTTTAGGG - Intergenic
1187230670 X:17419528-17419550 ACATAAATTGACACAATTCAGGG - Intronic
1187474470 X:19598766-19598788 TCTTATATGGGCACAGTTTATGG + Intronic
1187524386 X:20040707-20040729 TCTTATATGGGTGCAATTCATGG + Intronic
1187861219 X:23684920-23684942 CACTATATGGAAACTATTCAAGG - Intronic
1188274981 X:28189124-28189146 CCATAAATGGAAACACTTCATGG + Intergenic
1189263715 X:39697294-39697316 TCTTATGTGGTCACAGTTCATGG + Intergenic
1193342157 X:80361743-80361765 CCTAATATAGACACAGTTCTTGG + Intronic
1194579094 X:95649287-95649309 CCTTATTTGGGTATAATTCAGGG - Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1198490598 X:137136477-137136499 ACTTATATGGATGCAGTTCATGG + Intergenic
1199409321 X:147502184-147502206 ACTTATATGGGCACAATTCATGG - Intergenic
1200389227 X:155926967-155926989 CCTTATATAGGCACAGTTTATGG + Intronic