ID: 931612965

View in Genome Browser
Species Human (GRCh38)
Location 2:64123781-64123803
Sequence CAATTCCTAGGTATATACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 16, 3: 90, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931612962_931612965 15 Left 931612962 2:64123743-64123765 CCAGATTAAACATTAAGTTCTCA 0: 1
1: 0
2: 0
3: 16
4: 224
Right 931612965 2:64123781-64123803 CAATTCCTAGGTATATACCCAGG 0: 1
1: 0
2: 16
3: 90
4: 292
931612961_931612965 18 Left 931612961 2:64123740-64123762 CCTCCAGATTAAACATTAAGTTC 0: 1
1: 0
2: 0
3: 13
4: 128
Right 931612965 2:64123781-64123803 CAATTCCTAGGTATATACCCAGG 0: 1
1: 0
2: 16
3: 90
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931612965 Original CRISPR CAATTCCTAGGTATATACCC AGG Intronic
900152819 1:1186539-1186561 CCATTCCTGGGTATTTTCCCAGG - Intronic
900470667 1:2853118-2853140 CATTTCTTGGGTAAATACCCAGG + Intergenic
900812590 1:4818585-4818607 TCACTCCCAGGTATATACCCTGG + Intergenic
901418113 1:9130925-9130947 CCATTCCTAGGTATACACATAGG - Intergenic
902180088 1:14681374-14681396 CCAGTCCTAGATATTTACCCAGG - Intronic
903841628 1:26246234-26246256 CTACTCTTAGATATATACCCAGG + Intronic
908306911 1:62828152-62828174 TGATTACTGGGTATATACCCAGG - Intronic
908591598 1:65642809-65642831 TTACTCCTAGGTATATACTCAGG - Intergenic
909505224 1:76380450-76380472 CTATTTCTAGGTGTATACCCAGG + Intronic
910243366 1:85112440-85112462 CTATTCCTAGGGATGTACCCAGG - Intronic
910782828 1:90959387-90959409 CAATGCCTAGATATACATCCAGG + Intronic
911249963 1:95564213-95564235 TTACTCCTAGGTATTTACCCAGG - Intergenic
911555811 1:99343191-99343213 CCATTACTGGGTATATACCCAGG + Intergenic
911604178 1:99883330-99883352 CTATCCCTAGGTATATATCTGGG + Intronic
911681076 1:100716468-100716490 CAATTCCTAGGTAGAATACCTGG + Intergenic
912637112 1:111307089-111307111 CCATTCCTAGGTGTAAACACTGG + Intronic
913695875 1:121324983-121325005 CATTTGCAAGGTATAAACCCAGG + Intronic
914141691 1:144955076-144955098 CATTTGCAAGGTATAAACCCAGG - Intronic
915764005 1:158344627-158344649 CCATTACTGGGTATATACCCAGG - Intergenic
916771092 1:167909382-167909404 CCACTCCTGTGTATATACCCAGG - Intronic
917063537 1:171066881-171066903 CAACTCCTACTTAGATACCCAGG + Intergenic
918530205 1:185511380-185511402 CTACTCCTAGGAATTTACCCAGG - Intergenic
919071116 1:192756273-192756295 CATTGTCTGGGTATATACCCTGG + Intergenic
919936789 1:202256718-202256740 CCATTTCTAGTTAGATACCCAGG - Intronic
920483200 1:206343351-206343373 CATTTGCAAGGTATAAACCCAGG + Intronic
920981618 1:210841741-210841763 CAGATCCTATGTATATACACAGG - Intronic
922296920 1:224258535-224258557 CCACTCCTAGGTATAGACCCAGG + Intronic
923392500 1:233527803-233527825 CTATTCCTAAGTATTTATCCTGG + Intergenic
923544011 1:234911036-234911058 CCATTGCTGGGTATATACCCAGG + Intergenic
923675575 1:236078095-236078117 CCATTACTGGGTATATACCCAGG + Intergenic
923698028 1:236273840-236273862 CTATTCCTAAGCATATAACCTGG - Intronic
1065092483 10:22248971-22248993 CACTTCATATGTATATATCCTGG + Intergenic
1065597370 10:27327672-27327694 CCATTACTGGGTATATACCCAGG - Intergenic
1067934129 10:50593956-50593978 CCTCTCCTAGGTATATACCCTGG - Intronic
1069730063 10:70605283-70605305 CCACTCCTAGATATATACTCAGG - Intergenic
1070443839 10:76474842-76474864 CCACTCCTAGGTATATACCCAGG + Intronic
1075287889 10:121202864-121202886 CAATTCCAAGGTCTATTCTCGGG + Intergenic
1075462615 10:122628158-122628180 GTATTCCTAGGTATATACCCAGG + Intronic
1076324741 10:129612495-129612517 CATTACCTAGTTTTATACCCGGG + Intronic
1077446749 11:2596325-2596347 CTATTCCTAGGTATTTATCCAGG + Intronic
1077757617 11:5051188-5051210 CCACTTCTATGTATATACCCTGG - Intergenic
1081895533 11:46582642-46582664 CATTTGCTAGCTATATACCTTGG + Intronic
1082753225 11:57045105-57045127 CTTTTCCCAGGTATATACCCTGG + Intergenic
1082919416 11:58476573-58476595 CTATTTCTAGGTATATACTCAGG + Intergenic
1083030871 11:59590866-59590888 GAATTTCTAGGTATTTGCCCTGG - Intronic
1085654474 11:78300455-78300477 CCACTCCTAGGTATTTAACCAGG - Intronic
1085903067 11:80725302-80725324 CAGTTCCTAGGTATTTACTCAGG - Intergenic
1087818043 11:102680433-102680455 CAATTCATATTTAGATACCCTGG - Intergenic
1088323361 11:108576063-108576085 CCATTCCTACCTATATACTCTGG + Intronic
1088683275 11:112263460-112263482 CCACTCATAGGTATATACCCAGG + Intronic
1088732110 11:112692855-112692877 CAATTCCTTATTATATAGCCTGG + Intergenic
1089030510 11:115322936-115322958 ACACTCCTAGTTATATACCCAGG - Intronic
1089448255 11:118571433-118571455 CCACTCATAGGTACATACCCAGG - Intronic
1089935629 11:122361154-122361176 CCACTCCTGGGTATATCCCCAGG - Intergenic
1090811048 11:130243655-130243677 CCATTCCTAAGTATATACTGTGG - Intronic
1091081932 11:132679235-132679257 CTATTCCTAGATACATACACAGG + Intronic
1091606859 12:1960032-1960054 CCATTTCTGGGTATATATCCAGG + Intronic
1091839696 12:3611987-3612009 CCATTCATTGGTAAATACCCAGG + Intronic
1091861790 12:3792122-3792144 CACTTCCTAGCTATGTGCCCTGG + Intronic
1092281146 12:7098453-7098475 CTACTGCTAGGTATATACCCAGG + Intronic
1092779812 12:11975380-11975402 CTATTCCTGGGTATATACTCAGG + Intergenic
1094403513 12:30088550-30088572 CACTCCCTTGGTATTTACCCGGG - Intergenic
1094579051 12:31717039-31717061 TAATACCTAGGTGTATATCCCGG - Intronic
1094805695 12:34088817-34088839 CCATTACTGGGTATATACCCAGG + Intergenic
1095046062 12:37507449-37507471 CAACCCCTACTTATATACCCTGG + Intergenic
1096295280 12:50378836-50378858 CCATTTCTAGGAATATACCTTGG + Intronic
1097610728 12:61816523-61816545 CCATTACTGGGTATATACTCAGG - Intronic
1097778548 12:63676124-63676146 CCACTCCTAGGTGTACACCCAGG - Intergenic
1098366278 12:69706504-69706526 CAATTACAAGGTATATACAAAGG - Intergenic
1101013832 12:100478769-100478791 TAATTCCTAGGTATCTTTCCTGG - Intronic
1101767516 12:107715889-107715911 CTACTCCTTGGTATATATCCAGG + Intergenic
1101892310 12:108728189-108728211 ACATTCCTAGGTAAATACTCAGG + Intronic
1103178078 12:118881916-118881938 CCATTCCTAGCTATATACCTAGG - Intergenic
1103220804 12:119243131-119243153 CCGCTCCTAGGTATATACCAAGG - Intergenic
1103671193 12:122617212-122617234 CCACTTCTAGGTATATACTCAGG - Intronic
1104002254 12:124867443-124867465 CCACTCCTGGGTATATGCCCAGG + Intronic
1104054791 12:125221217-125221239 TAGTTCATAGATATATACCCAGG + Intronic
1104175546 12:126328717-126328739 CCACTCCTAGGTACATACTCGGG - Intergenic
1106006786 13:25778062-25778084 CAGTTACTATGTATAGACCCAGG + Intronic
1106181795 13:27375843-27375865 CAATTCCAAGTTAAATACCCAGG - Intergenic
1108222323 13:48248559-48248581 CCATTCCTAGGTATAAATCCTGG - Intronic
1108240787 13:48461496-48461518 CTACTCCTAGGTATGTACCTAGG - Intronic
1110071452 13:71183835-71183857 CTACTTCTAGGTATTTACCCAGG + Intergenic
1110253187 13:73403446-73403468 CTATGCTTAGGCATATACCCTGG + Intergenic
1111267567 13:85837632-85837654 CCATTCCTAGATACATACCCAGG + Intergenic
1112297807 13:98203746-98203768 CCACTCCTAGGTATCTTCCCAGG - Intronic
1112613456 13:100978825-100978847 CCACTCCTTGGTATTTACCCAGG + Intergenic
1112668002 13:101598936-101598958 CCATTACTGGGCATATACCCAGG - Intronic
1113265693 13:108615438-108615460 CTACTCCTATGTATAGACCCAGG + Intronic
1113565840 13:111319209-111319231 CCACTCCTAGGGATATACCAAGG + Intronic
1116214801 14:42000532-42000554 CCACTGCTAGGTATATACTCAGG - Intergenic
1116724435 14:48544498-48544520 CCATTACTGGGTATATACCCTGG - Intergenic
1118789443 14:69076284-69076306 CAATTCTTGGATATATACCTAGG - Intronic
1119176532 14:72572283-72572305 CCATTCATAGGTATATACCCAGG + Intergenic
1119614224 14:76088014-76088036 TAATTCCTAGGAATCTACCTAGG - Intergenic
1120575086 14:86172075-86172097 CCACTACTAGGTATCTACCCAGG + Intergenic
1121609892 14:95270818-95270840 CTACTCCTAGGTGTATACCCAGG - Intronic
1121726432 14:96155240-96155262 CTGCTCCTAGGTATTTACCCAGG + Intergenic
1122209313 14:100164805-100164827 CTACTCCTGGGTATAGACCCTGG - Intergenic
1122682853 14:103479347-103479369 TTATTCCTAAATATATACCCAGG - Intronic
1122731767 14:103805181-103805203 CCACTCCTAGGTACCTACCCTGG + Intronic
1125611228 15:40972143-40972165 CCATTCCTAGGTACATACCCAGG - Intergenic
1126548864 15:49904828-49904850 CAATTCCTAGTTATATCACTGGG + Intronic
1126787452 15:52189270-52189292 CTACTTCTAGATATATACCCAGG + Intronic
1127648136 15:60977956-60977978 CAATTCTTGGATATATACCTAGG + Intronic
1128316646 15:66663699-66663721 CAGTTCCTAGGTATTTACCCAGG - Intronic
1128371911 15:67046130-67046152 CTACTCCTAGTTACATACCCAGG - Intergenic
1128377807 15:67089841-67089863 CGCTTCCTAGCTATATGCCCTGG - Intronic
1129577628 15:76768189-76768211 CCACTCCTAGATATATATCCAGG + Intronic
1129773838 15:78220942-78220964 CCACTCCTTTGTATATACCCAGG + Intronic
1130073360 15:80667657-80667679 CAATTCCTAAGTCAATAACCAGG - Intergenic
1130367134 15:83250799-83250821 CCACTCCTAGGTATATACCCAGG + Intergenic
1133016821 16:2946984-2947006 CCACTCCTAGGTATGTACCCAGG + Intronic
1133162883 16:3923525-3923547 CCACTCCTATGTATATACCCGGG + Intergenic
1133595183 16:7284275-7284297 CCACTCCTAGGAATTTACCCAGG - Intronic
1133870767 16:9683690-9683712 TCACTCCTAGATATATACCCAGG + Intergenic
1136059426 16:27715930-27715952 CCATTCCTAGGTGCATACCCAGG + Intronic
1137958281 16:52854847-52854869 CCATTACTGGGTATATACACAGG - Intergenic
1138450438 16:57091004-57091026 CCACTCCTAGATATCTACCCGGG - Intergenic
1139201244 16:64979710-64979732 CCACTCCTAGGTATATGCCCAGG + Intronic
1140938030 16:79693456-79693478 CAACTCCCAGGAATATGCCCTGG - Intergenic
1141870510 16:86782298-86782320 CCATTCCTAAGCATATCCCCTGG - Intergenic
1142940662 17:3377932-3377954 CTGTTCCTAGGTATATAACAAGG + Intergenic
1143397561 17:6614251-6614273 TCACTCCTAGGTATATACTCAGG + Intronic
1143992358 17:10976971-10976993 TCATTCCTTGGTATATACCAGGG + Intergenic
1144750536 17:17645201-17645223 CCACTCCTAGGTGTATACTCAGG + Intergenic
1145979672 17:29004311-29004333 GAATTCCTAGGGACATCCCCAGG + Intronic
1146435023 17:32836892-32836914 TAACTCCTAGGTATATACTCAGG - Intronic
1146544063 17:33723049-33723071 CCATTCCTAAGGATACACCCAGG + Intronic
1146560622 17:33866231-33866253 CACTTCTTAGTTATATACCTAGG + Intronic
1149748980 17:59127306-59127328 CAATTCCTAGGTTTATCCTCTGG - Intronic
1150057112 17:62028041-62028063 CCATTACTGGTTATATACCCAGG + Intronic
1151646845 17:75438328-75438350 CCACTCCTAGGCATCTACCCAGG + Intergenic
1152863171 17:82707838-82707860 CTACTCCTACGTATATGCCCAGG - Intergenic
1153117168 18:1673105-1673127 TCATTCCTAGGTACATACCCAGG + Intergenic
1155604644 18:27590780-27590802 CCATTCCTAGGTACACACCTTGG - Intergenic
1155901288 18:31394236-31394258 CAATTCCTACTTATAGACCAAGG + Intronic
1156823202 18:41397925-41397947 CATTTCCAAGGTATAAAACCTGG + Intergenic
1159260787 18:66009542-66009564 CAACTCCTGGGTAAATACCAAGG - Intergenic
1160547484 18:79669799-79669821 GAATTCCTAAGTGTATGCCCAGG - Intergenic
1161296143 19:3521200-3521222 CACTTCCTAGATACACACCCAGG - Intronic
1161667225 19:5584647-5584669 CCAGTCCCAGGTATATACACAGG + Intergenic
1162464972 19:10834427-10834449 TCATTTCTAGGTATAAACCCTGG - Intronic
1164582619 19:29443865-29443887 GCACTCCCAGGTATATACCCAGG - Intergenic
1164917188 19:32061239-32061261 CAATGCCTAGGAAAATATCCTGG + Intergenic
1166592755 19:44015535-44015557 CAATTCAGAGTTATATACCATGG + Intergenic
1166890737 19:45991157-45991179 TAATTCCCAGGTATACACCTAGG + Intergenic
1168179516 19:54651418-54651440 CTATTACTGGGTATATATCCAGG - Intronic
1168464645 19:56592099-56592121 CAAATCCTAGCCAGATACCCAGG - Intergenic
1168482145 19:56729960-56729982 CCATTACTGAGTATATACCCGGG + Intergenic
926354472 2:12028188-12028210 CCACTGCTAGGTATATATCCAGG - Intergenic
927604577 2:24474983-24475005 CCACTCCTTGATATATACCCAGG + Intergenic
928592343 2:32830478-32830500 TCATTACTAGGTATATACCTAGG + Intergenic
928601387 2:32907220-32907242 CCACTCCTAGGTATATACCCAGG + Intergenic
928800189 2:35079987-35080009 CATCTCCTAGGTATACACCCAGG - Intergenic
929634441 2:43503201-43503223 CTACTTCTAGGTATATAACCTGG + Intronic
931603179 2:64024517-64024539 CAACTGCTATGTATTTACCCTGG + Intergenic
931612965 2:64123781-64123803 CAATTCCTAGGTATATACCCAGG + Intronic
931929551 2:67115047-67115069 CTATTCCTAATTATTTACCCTGG - Intergenic
932007697 2:67943996-67944018 CCATTAGTGGGTATATACCCAGG + Intergenic
932171543 2:69562076-69562098 CCATTCCTGGGTACATACCTAGG - Intronic
932524237 2:72446133-72446155 CCATTACTAGGTATATAACCAGG + Intronic
933814780 2:86057450-86057472 CTACTTCTAGGTATATACCCAGG + Intronic
934980429 2:98835237-98835259 CATTTCCTAGCTATATCCACTGG + Intronic
935759551 2:106307849-106307871 CCATTTCTAGGTATTTACCTAGG - Intergenic
936580868 2:113699457-113699479 CTACTCCCAGGTATATATCCAGG + Intergenic
937306977 2:120877869-120877891 CCATTCCTAGGTATATACCTGGG - Intronic
938249517 2:129803454-129803476 CTACTCCTAGGCATATACCCAGG + Intergenic
940948816 2:159648814-159648836 CATCTCCTGGGTATATACCAAGG + Intergenic
940948817 2:159648819-159648841 CCACTCCTTGGTATATACCCAGG - Intergenic
941575906 2:167229936-167229958 CCATGCCTAAGTAGATACCCAGG - Intronic
941977908 2:171425277-171425299 AAGTACCTAGGTATATACTCTGG + Intronic
942050776 2:172138746-172138768 TCATTATTAGGTATATACCCAGG + Intergenic
942320878 2:174734783-174734805 CCACTCCTATGTACATACCCAGG - Intergenic
942948196 2:181692675-181692697 CTATTCTTAGGGATATACCTAGG - Intergenic
943357638 2:186877020-186877042 CATTTCCTTTGGATATACCCTGG + Intergenic
943904268 2:193477515-193477537 CTACTCCTAGGTATTTACCAAGG + Intergenic
943973395 2:194440395-194440417 TAATCCTTTGGTATATACCCAGG + Intergenic
947086901 2:226463487-226463509 AGATTCCTAGGTATTTACCCAGG + Intergenic
948547136 2:238740800-238740822 CCACTCCTAGGCATGTACCCAGG + Intergenic
1169307963 20:4509913-4509935 TAACTCCTAGGTATATATACAGG - Intergenic
1169349920 20:4860113-4860135 CCACTCTTAGGTATATACCCAGG + Intronic
1170323285 20:15126202-15126224 CTATTCCTAGGTGTATATGCAGG - Intronic
1170955540 20:20976102-20976124 CCACTCCTAGGTATACGCCCAGG - Intergenic
1171307253 20:24117095-24117117 CCATTCCTAGTTACTTACCCTGG + Intergenic
1171800452 20:29609290-29609312 CAACCCCTACTTATATACCCTGG - Intergenic
1171843649 20:30247418-30247440 CAACCCCTACTTATATACCCTGG + Intergenic
1171955956 20:31463935-31463957 CACTTCCTAGGTTTATGACCTGG + Intergenic
1172394295 20:34588809-34588831 CCATTTCTAGGTATGTATCCTGG + Intronic
1172454865 20:35062276-35062298 CCACTTCTAGGTATATACCAAGG + Intronic
1172760799 20:37320093-37320115 CAAATCCCAGGCAGATACCCAGG + Intergenic
1172961276 20:38801918-38801940 CTACTCCTAGGTATATACTCAGG - Intergenic
1173177119 20:40772900-40772922 CATTGCCTAGGTTTAAACCCTGG - Intergenic
1173214289 20:41065872-41065894 CTACTCCTAGGTATACACCCCGG - Intronic
1173765187 20:45600824-45600846 CCACTCCTAGGAATATACCAGGG - Intergenic
1174371691 20:50093666-50093688 CCACTCCTAGGTATACACCCAGG + Intronic
1175038532 20:56023347-56023369 CCATTACTGGGTATATAACCAGG + Intergenic
1176940570 21:14919373-14919395 CCACTCCTAGGTATTTATCCAGG - Intergenic
1177191376 21:17855691-17855713 CCCCTCCTAGGTATATATCCAGG - Intergenic
1182014126 22:27024951-27024973 CCATTCCTGGGTATATTCCAAGG - Intergenic
1183682138 22:39338296-39338318 TCATTCTTAGGTATATACCCTGG - Intergenic
1183694228 22:39411715-39411737 TCACTCCTAGGTATTTACCCTGG + Intronic
1183919733 22:41155945-41155967 CCACTCCTAGGTAAATACCAAGG - Intronic
1184630159 22:45771084-45771106 GCATTCCTAAGTATTTACCCTGG + Intronic
1184793532 22:46717269-46717291 CCATTCCCAGGTATGCACCCAGG + Intronic
1184966938 22:47983557-47983579 CTACCCCTAGGTATATGCCCAGG - Intergenic
949442776 3:4101131-4101153 TCATTACCAGGTATATACCCAGG + Intronic
949524881 3:4893619-4893641 CCATTACTGGGTATATACTCAGG + Intergenic
949570427 3:5286993-5287015 CCATTACTGGGTATCTACCCAGG - Intergenic
949718237 3:6958529-6958551 CCACTCCTAGATATTTACCCAGG - Intronic
950298958 3:11857357-11857379 CAAATCCTAGATATTTACCCTGG - Intergenic
950564093 3:13754958-13754980 CCACTCCTAGGTGTATACTCAGG - Intergenic
951624822 3:24647526-24647548 TAATTTCTAGGTATATGCCAAGG + Intergenic
952363045 3:32650055-32650077 CTACACCTAGGTATATACCCAGG - Intergenic
952550802 3:34474492-34474514 CTACTCCTAAGTATTTACCCAGG - Intergenic
952882756 3:37995094-37995116 CTGCTCCTAGGTATATACCAAGG - Intronic
954910295 3:54100502-54100524 AAATTCCTAGGTATTTACTCAGG - Intergenic
955345575 3:58159006-58159028 CATTTCCTAGCTATATATCTAGG - Intronic
956045020 3:65186580-65186602 CTACTCCTATGTATATATCCAGG - Intergenic
956923929 3:73961832-73961854 CCACTCCTAAGTATATGCCCAGG - Intergenic
957004458 3:74928033-74928055 CCATTTCTAGGAATATACACAGG + Intergenic
957034941 3:75285354-75285376 CCACTCCTGGGTATACACCCAGG - Intergenic
957647800 3:82955733-82955755 CTACTCCTAGGTATATGCCAAGG - Intergenic
957911487 3:86624654-86624676 CAAACCCTAGGTATATCCCCAGG + Intergenic
958013208 3:87907037-87907059 CCACTCCTAGGTATCTACCCAGG - Intergenic
958030374 3:88101676-88101698 CTATGCCTAGGTATCTACCTAGG - Intronic
958998756 3:100937312-100937334 TCATTCCTAGGTATTTACTCAGG + Intronic
959548184 3:107622430-107622452 CCACTCCTAGGTATTAACCCTGG - Intronic
961304650 3:125949501-125949523 CCACTCCTGGGTATACACCCGGG + Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
964795289 3:160490243-160490265 CCACTCCTAGGTATTTACTCAGG - Intergenic
965397742 3:168180487-168180509 CAATTCAGAAGTATATACCAAGG - Intergenic
965775892 3:172230950-172230972 CATTTCTCAGGTATATACCTAGG - Intronic
966520307 3:180867586-180867608 CTAATCCTAGGTATATACTCAGG + Intronic
967537976 3:190628961-190628983 CAATTCCTGGCTATATACTTTGG - Intronic
968322069 3:197778889-197778911 CTACTCCTAGGTATTTACCAGGG - Intronic
968601206 4:1510408-1510430 CCACTCCTAGGCATTTACCCAGG - Intergenic
968711507 4:2122809-2122831 CTACTCCTAGGTATACACTCAGG + Intronic
969036465 4:4257707-4257729 CCATTACTGGGTATATACTCAGG + Intergenic
969352814 4:6607733-6607755 CTACTCCTAGCTATGTACCCAGG - Intronic
969871133 4:10105761-10105783 CCACTCCTAGGTATCTGCCCTGG + Intronic
970269605 4:14330969-14330991 TCATTCCTGGGTATCTACCCAGG - Intergenic
970375144 4:15449675-15449697 CCATTACTGGGTATATACCCAGG + Intergenic
972097568 4:35367350-35367372 CCATTACTGGGTATATGCCCAGG - Intergenic
972682817 4:41323404-41323426 GCATTTCTAGGTATATACTCTGG - Intergenic
972712230 4:41609015-41609037 AAATTCCTAGTAATGTACCCTGG + Intronic
973027332 4:45289131-45289153 GTATTCCTAGGTATATTCCTAGG + Intergenic
973027333 4:45289136-45289158 AAATACCTAGGAATATACCTAGG - Intergenic
974879836 4:67741551-67741573 CCACTACTAGGTATCTACCCAGG - Intronic
975515355 4:75241565-75241587 CAACTCCTAGGTATTTACCTAGG - Intergenic
976066815 4:81197220-81197242 CCATTCCTTGCTAGATACCCAGG - Intronic
977259365 4:94780521-94780543 CCACTCCTAGGTATATACCCAGG - Intronic
977503079 4:97865578-97865600 CCATTACTGGGTGTATACCCAGG + Intronic
977585026 4:98765400-98765422 AAACTTCTAGGTATATATCCAGG - Intergenic
978896479 4:113894524-113894546 TCATTCCTAGGAATATACCCTGG - Intergenic
979212428 4:118121284-118121306 CAATTGCTAGAAATATACCAAGG - Intronic
981736702 4:147961051-147961073 CCACTCGTAGGTATATAACCAGG - Intronic
982020379 4:151197140-151197162 TGATACCTAGGTAGATACCCAGG - Intronic
983315635 4:166129414-166129436 CCATTACTGGGTATATACCCAGG - Intergenic
984257802 4:177408448-177408470 CAATGCCTGGGTTTATATCCCGG + Intergenic
984657615 4:182336028-182336050 AACTTCCTAGGCATATTCCCTGG - Intronic
986826336 5:11526743-11526765 CCACTCCTAGGTACACACCCAGG + Intronic
987661656 5:20886047-20886069 CCATTACTAAGTGTATACCCAGG + Intergenic
987664640 5:20921568-20921590 CAGTTTCTAGGTATATAAACAGG + Intergenic
987822074 5:22978471-22978493 CCACTACTAGGTATCTACCCAGG + Intergenic
988578594 5:32449450-32449472 CCACTCCTAGGGATATACTCAGG - Intergenic
988608226 5:32700897-32700919 CCATTACTGGGTATATACCCAGG - Intronic
988715906 5:33828038-33828060 CCATTCCTGGGTATATGCCCTGG - Intronic
988761926 5:34319261-34319283 CCATTACTAAGTATATACCCAGG - Intergenic
988905029 5:35778510-35778532 CAATTCCTAGCTAGATAACATGG - Intronic
989403248 5:41032078-41032100 CCATTCCTTGGTATATACCCAGG - Intronic
990771228 5:59248238-59248260 TAATTCCTAGACATATGCCCAGG - Intronic
991335078 5:65537921-65537943 TCATTCCTGGATATATACCCAGG - Intronic
991645638 5:68798207-68798229 CTAATCCTAGGTATTTACCCTGG + Intergenic
992310710 5:75496461-75496483 CCATTCATAGGTATCTACCCAGG + Intronic
993003749 5:82408893-82408915 ACAATCCTAGGTATGTACCCAGG - Intergenic
993348137 5:86811219-86811241 CAAGTTATAGGTATATATCCTGG - Intergenic
993498687 5:88638892-88638914 CCACTCCTAGGTATTTACCCAGG + Intergenic
994469202 5:100181032-100181054 CTACTCCTAGGTATATATCCAGG - Intergenic
995622251 5:114039335-114039357 AAATGCCTGGGAATATACCCTGG + Intergenic
996076389 5:119199567-119199589 CCATTACTGGGTATATACCTAGG - Intronic
996620097 5:125490016-125490038 CCACTCCTAGGAATTTACCCAGG - Intergenic
998210911 5:140197403-140197425 CCTTTCCTATGGATATACCCAGG + Intronic
998239996 5:140432575-140432597 TACTTCTTAGGTATATACCTAGG - Intronic
998273678 5:140731174-140731196 TGACTCCTAGGTATGTACCCTGG - Intergenic
998585778 5:143425864-143425886 CAACTCCTAGGAATTTACCCAGG + Intronic
999007117 5:147994918-147994940 CTATTCCTAGGTGTTTACCCAGG - Intergenic
1000162747 5:158615826-158615848 CCATTACTGGGTAGATACCCAGG - Intergenic
1002826628 6:779917-779939 CTACTCCTAGGTCCATACCCAGG + Intergenic
1003661074 6:8062845-8062867 TCATGCCTAGGTATGTACCCTGG + Intronic
1004670892 6:17795657-17795679 CCACTCATAGGTATTTACCCAGG - Intronic
1006420328 6:33929762-33929784 CCACTCATAGGTATATACCAAGG + Intergenic
1007272215 6:40646652-40646674 GAGATCCTAGGTACATACCCAGG + Intergenic
1007272309 6:40647656-40647678 GAGATCCTAGGTACATACCCAGG + Intergenic
1008469766 6:51871165-51871187 CAACTCCTAGGTATTTACCTTGG + Intronic
1009879097 6:69542624-69542646 CATTTCCTAGTTGTATACTCTGG - Intergenic
1009917754 6:70017000-70017022 CTTTTCTTAGGTAAATACCCAGG - Intronic
1015223958 6:130835179-130835201 GATTTCCTGGGTATATACACTGG + Exonic
1015288888 6:131515364-131515386 TCATTACCAGGTATATACCCAGG - Intergenic
1015614229 6:135058277-135058299 CTACTCCTAGGTATTTACCCAGG - Intronic
1016202925 6:141434675-141434697 CAATCCCTGAGTATATATCCAGG + Intergenic
1016604185 6:145900142-145900164 CTATTTCTGGGTATATATCCAGG + Intronic
1017244843 6:152212631-152212653 CCACTCCTAGGTATATACTCAGG - Intronic
1017433432 6:154393232-154393254 TCATTCCTAGATATATATCCTGG - Exonic
1018725231 6:166607273-166607295 CCACTCCCAGGTATAAACCCAGG + Intronic
1020082719 7:5295501-5295523 CAAGTCCTAGGTCTGTCCCCTGG + Intronic
1021277525 7:18672060-18672082 TCACTCCTAGATATATACCCAGG - Intronic
1021435205 7:20605958-20605980 CCATTACTGGGTATATACCCAGG + Intergenic
1021608053 7:22429166-22429188 CCACTCATAGGTTTATACCCTGG + Intronic
1022937479 7:35193789-35193811 CCACTCCTAGGTGTACACCCAGG - Intergenic
1024627211 7:51218137-51218159 CCAATCCTAGGTATATTCCGAGG + Intronic
1024665122 7:51538508-51538530 CCACTCCTGGGTATCTACCCAGG - Intergenic
1025280957 7:57626225-57626247 CGAGACCTAGGTATCTACCCAGG - Intergenic
1025292051 7:57737290-57737312 CAACCCCTACTTATATACCCTGG + Intergenic
1027547237 7:79542947-79542969 CCTTTCCTAGGTATTTACCGGGG - Intergenic
1028001827 7:85508505-85508527 CATTGCCTGGGTATATACTCTGG + Intergenic
1028042369 7:86070201-86070223 CATTTCCTTGGGATATATCCAGG + Intergenic
1029833640 7:103286432-103286454 CCACTCCTAGGTGTACACCCAGG - Intergenic
1029984726 7:104912576-104912598 TTATTCCTAGGTATATATGCTGG + Intergenic
1030112715 7:106040322-106040344 TATTTCCTAGGTATATACCTAGG + Intergenic
1030112716 7:106040327-106040349 CCATTCCTAGGTATATACCTAGG - Intergenic
1030339820 7:108364494-108364516 CCACTCCTATGTATAGACCCGGG + Intronic
1030802550 7:113870040-113870062 CAATTCATAGGTATATTTCGTGG - Intergenic
1030815831 7:114036329-114036351 CTATTCCTAGTTATATGCTCAGG - Intronic
1031501089 7:122517403-122517425 CCACTCCTAGGTATTTACCCAGG - Intronic
1032243069 7:130180948-130180970 CCACCCCTAGGTATATACCCAGG + Intronic
1032549256 7:132769330-132769352 CTATACCTAGGAATATACCCAGG - Intergenic
1033261691 7:139849578-139849600 AAATTCCTAGGTACGTCCCCAGG - Intronic
1033382957 7:140841380-140841402 CTATTCCTAGGCATACAGCCAGG + Intronic
1034138422 7:148793756-148793778 CTATACCTAGGTATATACCCAGG - Intronic
1035176095 7:157052111-157052133 CCACTCCTAGGTATATACCCAGG + Intergenic
1035490646 7:159273897-159273919 CCATTACTGGGTATATACCCAGG + Intergenic
1035697153 8:1607024-1607046 CCACTCCTTGGTATATGCCCAGG - Intronic
1037568594 8:20139461-20139483 TTACTCCTAGGTATATACCCAGG + Intergenic
1038313060 8:26460462-26460484 GCATTCCTAGATATTTACCCAGG + Intronic
1038724421 8:30067864-30067886 CTATTCCTATGTACATACCTGGG - Intronic
1038852265 8:31291111-31291133 CCATTACTGGGTATACACCCAGG - Intergenic
1041232437 8:55767552-55767574 CAATTCCTAGATTTATATCAGGG - Intronic
1041453049 8:58027950-58027972 CTACTACTAAGTATATACCCAGG - Intronic
1044313180 8:90718988-90719010 CCATTACTGGGTATATACCCAGG + Intronic
1044481099 8:92689125-92689147 CCATTTCTAAGTATATACTCAGG - Intergenic
1044941204 8:97345777-97345799 CTCTTCCTGGGTATATATCCTGG + Intergenic
1045619517 8:103958042-103958064 CCATTACTGGGTATATTCCCAGG + Intronic
1045714904 8:105030637-105030659 CAAGTGCTAGTTATATACCTTGG + Intronic
1045793940 8:106020671-106020693 CCATCCCTAGGTATCTACCTGGG + Intergenic
1045793942 8:106020676-106020698 AAATTCCCAGGTAGATACCTAGG - Intergenic
1046210573 8:111069199-111069221 CAATTCCTAGGTATTAAGCCTGG + Intergenic
1046801088 8:118427779-118427801 CCACTCCAAGGTATCTACCCAGG - Intronic
1046992961 8:120481310-120481332 TCATTCCTAGATATTTACCCAGG + Intronic
1047297360 8:123582990-123583012 CCATTACTGGGTATATGCCCAGG + Intergenic
1048615327 8:136067792-136067814 TATTTCCTGAGTATATACCCTGG + Intergenic
1048960698 8:139574349-139574371 AAAATCCTAGGTTTATACCTAGG + Intergenic
1048960699 8:139574354-139574376 CCATTCCTAGGTATAAACCTAGG - Intergenic
1050755354 9:8996103-8996125 AAACTCCAAGGTATTTACCCAGG + Intronic
1050810295 9:9737838-9737860 AAATTCCTAAGTATATACCCAGG - Intronic
1050974936 9:11926109-11926131 ACATTACTAGGTATATACCCAGG + Intergenic
1051038858 9:12781759-12781781 CCACTACTAGGTATATACTCAGG - Intronic
1052765602 9:32636789-32636811 CCACTCCTAGATGTATACCCTGG - Intergenic
1053004487 9:34595033-34595055 CCGTTCCTAGATATATACCCAGG + Intergenic
1053386502 9:37695158-37695180 CCACTCCTAAGTATATACTCAGG - Intronic
1054164453 9:61708407-61708429 CAACCCCTACTTATATACCCTGG - Intergenic
1055883134 9:81026610-81026632 CCACTCCCAGGTATATACCCAGG + Intergenic
1056000764 9:82214198-82214220 CCACTCCTAGGTATATACTCAGG + Intergenic
1056699630 9:88891542-88891564 CATTCCCTTGGTATATACCTAGG + Intergenic
1057012980 9:91622975-91622997 CTATTCCTAGGTATAAACCCAGG - Intronic
1057603278 9:96478480-96478502 CCACTCCTAGGTATTTACCCAGG - Intronic
1057714124 9:97476060-97476082 CCATTCCTATGTATGTACCCTGG - Intronic
1058079138 9:100683528-100683550 CCACTCCTAGGTATTTCCCCAGG + Intergenic
1058591934 9:106574698-106574720 CCACTTCTAGGTATATACCCAGG + Intergenic
1058855297 9:109056143-109056165 AAATTCAGAGGTAAATACCCAGG + Intronic
1061819646 9:133219763-133219785 CCACTCCCAGGTATACACCCAGG + Intergenic
1185815580 X:3152079-3152101 CATTTCCTAGGTATATATTAAGG + Intergenic
1186315572 X:8365866-8365888 CAACTCCTACGTAGCTACCCTGG - Intergenic
1186393532 X:9184711-9184733 CCACTCCTAGGTATACACCCAGG + Intergenic
1186415224 X:9377572-9377594 CCATTACTGGGTATATACTCAGG - Intergenic
1186931918 X:14402712-14402734 CTATTCCTAGGTCTAGATCCTGG + Intergenic
1187517019 X:19981570-19981592 CCACTCCTAGATAGATACCCAGG + Intergenic
1187714403 X:22088311-22088333 CTACTTCTAGGTATTTACCCAGG - Intronic
1187930348 X:24287890-24287912 CCACTCCTAGGTATATACCCAGG - Intergenic
1188222902 X:27561913-27561935 CATTTCTTAGGTATATAACTAGG + Intergenic
1188234085 X:27705297-27705319 CATTTCTTAGGTATATAACTAGG + Intronic
1188471629 X:30546740-30546762 CAACTCCTAGGTGTACACCCAGG + Intergenic
1188851710 X:35140468-35140490 CCATTACTCGGTATATACCCAGG + Intergenic
1191862390 X:65676594-65676616 CACTTCCCAAATATATACCCAGG - Intronic
1191970589 X:66811161-66811183 CCATTACTGGGTATCTACCCAGG - Intergenic
1192037270 X:67577479-67577501 CCACTCCTAGGTGTATACCAAGG - Intronic
1192100478 X:68259043-68259065 CTATTTCTAAGTATATACCCAGG + Intronic
1193087800 X:77463047-77463069 CCACTGCTAGATATATACCCAGG - Intergenic
1193137710 X:77991573-77991595 CCACTCCTAGATATATACCCAGG - Intronic
1193230456 X:79038770-79038792 CTATTACTGGGTATATACCCAGG - Intergenic
1193517737 X:82490441-82490463 CCACTCCTGGGTATCTACCCAGG + Intergenic
1194007330 X:88511710-88511732 CAATTCCTAGATATATGACCTGG + Intergenic
1195769980 X:108340392-108340414 CAATTTCTAGATATATACACTGG - Intronic
1197027349 X:121769685-121769707 CTACTCCTAGGTACATATCCAGG - Intergenic
1197338768 X:125240792-125240814 CTACTTCTAGGTATTTACCCTGG + Intergenic
1198041972 X:132861689-132861711 CAATCACTAGTTATATTCCCTGG + Intronic
1199823014 X:151469825-151469847 GTATTCCTAGGTACATACCCAGG - Intergenic
1200001293 X:153061700-153061722 CCATTCCTAGGTATTTACTCGGG - Intergenic
1200897061 Y:8386946-8386968 GAATTCCTATATATATATCCAGG - Intergenic