ID: 931614570

View in Genome Browser
Species Human (GRCh38)
Location 2:64143773-64143795
Sequence CCGCGCGCTCCGGCTGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931614570_931614583 27 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549
931614570_931614577 -2 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614577 2:64143794-64143816 GGCCAGCCAGGCGCGGGGCTCGG 0: 1
1: 1
2: 3
3: 43
4: 410
931614570_931614585 30 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614585 2:64143826-64143848 CCGCGCGCCCCGCTCCCGGGCGG 0: 1
1: 0
2: 5
3: 27
4: 294
931614570_931614580 4 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614580 2:64143800-64143822 CCAGGCGCGGGGCTCGGAGTTGG 0: 1
1: 0
2: 1
3: 15
4: 247
931614570_931614576 -7 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614576 2:64143789-64143811 CGCGCGGCCAGCCAGGCGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 206
931614570_931614581 26 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614581 2:64143822-64143844 GCCGCCGCGCGCCCCGCTCCCGG 0: 1
1: 0
2: 3
3: 74
4: 472
931614570_931614575 -8 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614575 2:64143788-64143810 GCGCGCGGCCAGCCAGGCGCGGG 0: 1
1: 0
2: 2
3: 28
4: 234
931614570_931614574 -9 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614574 2:64143787-64143809 AGCGCGCGGCCAGCCAGGCGCGG 0: 1
1: 0
2: 3
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931614570 Original CRISPR CCGCGCGCTCCGGCTGCGAG AGG (reversed) Intronic
900511448 1:3062920-3062942 CCGGGCGCTCTGGCTGCTGGGGG - Intergenic
900558629 1:3292558-3292580 CCGCGCTGTCCGGATGAGAGTGG + Intronic
901791122 1:11654280-11654302 CCGCTCGCTGCGGCGGGGAGGGG - Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
902797774 1:18810439-18810461 CAGCGCCCGCCTGCTGCGAGGGG + Intergenic
902920653 1:19664728-19664750 CAGAGCGCCCCAGCTGCGAGGGG - Intergenic
907524082 1:55043896-55043918 CAGTGCGCTCTGACTGCGAGAGG - Exonic
913615872 1:120558880-120558902 CCACGTCCTCCGGCTGCCAGCGG + Intergenic
914574407 1:148952022-148952044 CCACGTCCTCCGGCTGCCAGCGG - Intronic
919730672 1:200911917-200911939 CCGCACGATGCGGCTGCGGGAGG - Exonic
1067113962 10:43420587-43420609 CCGGGCGCGCCTGCTGCGCGGGG + Intergenic
1076824736 10:132961149-132961171 CCGCGCGCTCTCAGTGCGAGGGG - Intergenic
1083800060 11:65041421-65041443 CCGCGCGCTGCGGATCCGCGCGG - Exonic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092294922 12:7189954-7189976 CCGCGTGCTGGGGCTGCGCGGGG + Intronic
1097019148 12:56007699-56007721 GCGCGCGCGCAGGCTGTGAGGGG - Exonic
1098255379 12:68610841-68610863 CCGCGCGCCCCGCCCGCGGGCGG + Exonic
1113082829 13:106535550-106535572 CCGCGGGCTCCGGACGCGCGCGG + Intergenic
1117803022 14:59464533-59464555 CCGCGCGCTGCAGCTGCTGGCGG - Exonic
1122137940 14:99645425-99645447 CCGCGTGCGCCGGCTACGCGAGG + Exonic
1122162287 14:99793271-99793293 GCGCCCGCTCCGCCCGCGAGGGG - Intronic
1122545047 14:102517337-102517359 CCGCGGACTCCGGCTGGGGGAGG - Intergenic
1123671594 15:22664615-22664637 CGGCGCGCGCCGGCAGCTAGCGG + Intergenic
1124323632 15:28737840-28737862 CGGCGCGCGCCGGCAGCCAGCGG + Intronic
1124789859 15:32717779-32717801 CCGCCCGGGCCGGCTGGGAGAGG - Intergenic
1128743249 15:70097253-70097275 CCGCGCGCCCCGGATGCTTGGGG - Exonic
1129322376 15:74782312-74782334 CCGCGGGCTCCGGCGGCCAGAGG - Exonic
1131160429 15:90101868-90101890 CCGCGCGCTCCCCTGGCGAGAGG - Intronic
1132398267 15:101489642-101489664 CCGCGCGCGCCGCCTGCGCCCGG - Exonic
1132556403 16:574641-574663 CCACGCCCTCCGACTGCCAGTGG - Exonic
1134134138 16:11668560-11668582 CCGCGCGCTCGGGCCGGGCGGGG + Intronic
1140376787 16:74451170-74451192 CCGCTCACTCCGGCTGGCAGTGG + Intergenic
1141132262 16:81444654-81444676 CCGCGGACTCCGCCCGCGAGAGG + Intergenic
1144724929 17:17496963-17496985 CCGCGCGCTCGGGCCGCCAGAGG + Intergenic
1146283641 17:31560194-31560216 GCGCTCGCCCCGGCTGCGTGCGG + Intergenic
1148048748 17:44759156-44759178 CCGGGGGCTGCGGCTGCCAGCGG - Exonic
1148684768 17:49495281-49495303 CGGCTCGCTCTGGCTGCGGGCGG - Exonic
1148821074 17:50360051-50360073 CCGCGAGCTCCGGCTGAGGCAGG - Exonic
1150790927 17:68199620-68199642 CCTCGCGCCCCGGCTCCGTGCGG - Intergenic
1152420417 17:80189824-80189846 CGGCCCGCTCCCGCAGCGAGTGG - Exonic
1160747812 19:720074-720096 CCCCGCGCTGCGGCTGGGGGAGG - Intronic
1160947768 19:1651697-1651719 CCGCCTGCACCGGCTGCGGGGGG - Intronic
1160991670 19:1862840-1862862 CCACGCGGTCGGGCGGCGAGCGG - Intronic
1161150066 19:2702782-2702804 TCGCGAGCCCCGGCTGCGGGAGG + Intergenic
1161388097 19:4007628-4007650 CAGCGCGCACCGGCGGCGGGAGG + Exonic
1161439074 19:4280216-4280238 CCGCGGGGTCCGGCTCCAAGCGG - Exonic
1162019498 19:7862238-7862260 CCGCGAGCTGCGGCAGCGCGTGG + Exonic
1162019545 19:7862414-7862436 CCGCGCGCTCCGCCTCCACGCGG - Exonic
1162776630 19:12983718-12983740 CCGCGCGCTCTTGCAGGGAGGGG + Intergenic
1165213737 19:34254739-34254761 CCGCGCCCTGCGGCCCCGAGCGG - Intronic
1166807586 19:45496631-45496653 CCCCGCGCTCTGGCGGCGACGGG - Intronic
1167505701 19:49870000-49870022 GCGCGCGCTGGTGCTGCGAGAGG - Exonic
1167638596 19:50668395-50668417 CCGTGGGCTCCGGCTGGGTGGGG + Exonic
925398888 2:3558006-3558028 CCGCGCGCTGTGGCTGTGGGTGG - Intronic
925730706 2:6917886-6917908 GCGCGGGCGCCGCCTGCGAGAGG - Intronic
929107192 2:38376960-38376982 CCGCGCGCTGCGGGAGCGCGGGG + Intronic
929107191 2:38376960-38376982 CCCCGCGCTCCCGCAGCGCGCGG - Intronic
929151145 2:38750506-38750528 CCGCGCGCTCCCGGTGCGCCCGG - Intronic
929452649 2:42047728-42047750 CCCCGAGCTCCGTCTGGGAGCGG - Intergenic
931166664 2:59756240-59756262 CCTCGCTCTCCTGCTGGGAGGGG - Intergenic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
933886136 2:86720485-86720507 AGGCGGGCTCCGGCTGCGCGGGG + Exonic
933924045 2:87076221-87076243 AGGCGGGCTCCGGCTGCGCGGGG - Intergenic
938368838 2:130756262-130756284 CCGCGCGCCGCGGCCGGGAGGGG - Intronic
946219832 2:218217106-218217128 CCGCGCGTCCAGGCGGCGAGCGG + Intronic
946248456 2:218399954-218399976 CCGCGAGCTCCGGAGGGGAGGGG - Exonic
1174128277 20:48324653-48324675 CCTTGTGCTCCGGCTGAGAGAGG + Intergenic
1175943592 20:62548860-62548882 CCACGCTCTCCCGCTGCCAGTGG + Intergenic
1179304473 21:40141836-40141858 CTTCGCCCTCAGGCTGCGAGTGG - Intronic
1181082951 22:20426146-20426168 CCGCGTCCTCCGACAGCGAGCGG - Exonic
1184593830 22:45502746-45502768 CCCCGGACCCCGGCTGCGAGGGG - Intronic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
950153897 3:10708200-10708222 CCGCGCGCTCCGGTCCCGCGGGG - Intergenic
952867153 3:37861893-37861915 CCGCCCGCTCCCGCTTCCAGCGG + Intergenic
952942361 3:38454284-38454306 CCGCGGGCTCCGGGTGTGCGCGG + Exonic
954392682 3:50275781-50275803 CCACGCGCGCCTGCAGCGAGCGG - Exonic
959951673 3:112185771-112185793 CCGCACGATGCGGCTGCGAGAGG + Intronic
961665092 3:128489522-128489544 CCGCGCGCTCCAGCGTGGAGGGG - Intronic
968362267 3:198155627-198155649 CCGCCGGCTCTGGCTGCGGGCGG + Intergenic
981061287 4:140427705-140427727 CTACGCGCTCCTGCTCCGAGGGG + Exonic
986233528 5:5887078-5887100 CCGCGCGCTCCCTCTGCTGGCGG - Intergenic
998337632 5:141387672-141387694 AAGCGCGCTGCGGCTGCGCGAGG - Intronic
998338739 5:141397918-141397940 AAGCGCGCTGCGGCTGCGCGAGG - Intronic
1001902745 5:175444811-175444833 CCGCGCGCTCCGTGTGCCCGGGG + Intergenic
1003577640 6:7312824-7312846 CCCCGCGCTCCGCGTGCAAGGGG + Intronic
1007553592 6:42747619-42747641 CCCCGCGCCCCGCCTGCGCGGGG - Intronic
1007576633 6:42929408-42929430 AGGCGGGCTGCGGCTGCGAGAGG + Exonic
1034347684 7:150397281-150397303 CCGCGGTCTCCGGCCCCGAGGGG + Exonic
1040688711 8:49909788-49909810 TCGCGAGCTCCGGCTGGAAGGGG - Intronic
1045653909 8:104367500-104367522 GAGCGCGCTCCGGGTGGGAGAGG + Intronic
1048009388 8:130443720-130443742 CCGCGCCCTCCGCCGCCGAGCGG - Intergenic
1049212236 8:141392102-141392124 CCGCGCGCCCCCGCCCCGAGCGG - Intronic
1049803183 8:144527506-144527528 CCGCACGCTCCGGCGCCGGGTGG + Exonic
1049987985 9:970168-970190 CCCCGCCCTCCCGCTGGGAGTGG - Intergenic
1051170168 9:14313747-14313769 CAGCGCGCTCGGACTGCAAGAGG - Intronic
1056216266 9:84408587-84408609 CCGCCGGCTCCGGCAGTGAGGGG + Intergenic
1058885824 9:109320645-109320667 CGGCCAGCGCCGGCTGCGAGTGG + Exonic
1061108792 9:128552528-128552550 ACGCGCGCTCCCGCGGCGGGCGG - Intergenic
1189323158 X:40098086-40098108 CCGAGCGCTGCGCCTGCGGGGGG - Intronic
1198177621 X:134172190-134172212 CCGCGCTCTCCACCTGCGAGGGG - Intergenic
1199699627 X:150365554-150365576 CCCTGAGCTCCGGCGGCGAGGGG - Intronic
1199772742 X:150984408-150984430 CCGCCCGCGCCGGCCGCGCGCGG + Intronic