ID: 931614570

View in Genome Browser
Species Human (GRCh38)
Location 2:64143773-64143795
Sequence CCGCGCGCTCCGGCTGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931614570_931614583 27 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549
931614570_931614581 26 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614581 2:64143822-64143844 GCCGCCGCGCGCCCCGCTCCCGG 0: 1
1: 0
2: 3
3: 74
4: 472
931614570_931614575 -8 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614575 2:64143788-64143810 GCGCGCGGCCAGCCAGGCGCGGG 0: 1
1: 0
2: 2
3: 28
4: 234
931614570_931614576 -7 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614576 2:64143789-64143811 CGCGCGGCCAGCCAGGCGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 206
931614570_931614580 4 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614580 2:64143800-64143822 CCAGGCGCGGGGCTCGGAGTTGG 0: 1
1: 0
2: 1
3: 15
4: 247
931614570_931614574 -9 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614574 2:64143787-64143809 AGCGCGCGGCCAGCCAGGCGCGG 0: 1
1: 0
2: 3
3: 14
4: 189
931614570_931614585 30 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614585 2:64143826-64143848 CCGCGCGCCCCGCTCCCGGGCGG 0: 1
1: 0
2: 5
3: 27
4: 294
931614570_931614577 -2 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614577 2:64143794-64143816 GGCCAGCCAGGCGCGGGGCTCGG 0: 1
1: 1
2: 3
3: 43
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931614570 Original CRISPR CCGCGCGCTCCGGCTGCGAG AGG (reversed) Intronic