ID: 931614583

View in Genome Browser
Species Human (GRCh38)
Location 2:64143823-64143845
Sequence CCGCCGCGCGCCCCGCTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 1, 2: 7, 3: 63, 4: 549}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931614578_931614583 4 Left 931614578 2:64143796-64143818 CCAGCCAGGCGCGGGGCTCGGAG 0: 1
1: 0
2: 0
3: 28
4: 223
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549
931614570_931614583 27 Left 931614570 2:64143773-64143795 CCTCTCGCAGCCGGAGCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549
931614573_931614583 17 Left 931614573 2:64143783-64143805 CCGGAGCGCGCGGCCAGCCAGGC 0: 1
1: 0
2: 2
3: 19
4: 234
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549
931614569_931614583 28 Left 931614569 2:64143772-64143794 CCCTCTCGCAGCCGGAGCGCGCG 0: 1
1: 0
2: 0
3: 3
4: 54
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549
931614568_931614583 29 Left 931614568 2:64143771-64143793 CCCCTCTCGCAGCCGGAGCGCGC 0: 1
1: 0
2: 0
3: 7
4: 66
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549
931614579_931614583 0 Left 931614579 2:64143800-64143822 CCAGGCGCGGGGCTCGGAGTTGG 0: 1
1: 0
2: 3
3: 13
4: 185
Right 931614583 2:64143823-64143845 CCGCCGCGCGCCCCGCTCCCGGG 0: 1
1: 1
2: 7
3: 63
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931614583 Original CRISPR CCGCCGCGCGCCCCGCTCCC GGG Intronic