ID: 931620038

View in Genome Browser
Species Human (GRCh38)
Location 2:64200613-64200635
Sequence CTCCAGTCTGCCAGGTACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931620038_931620041 -4 Left 931620038 2:64200613-64200635 CCACCGTACCTGGCAGACTGGAG No data
Right 931620041 2:64200632-64200654 GGAGTGCAGTGATGCCATCTCGG 0: 116
1: 4323
2: 39461
3: 100859
4: 145818
931620038_931620043 28 Left 931620038 2:64200613-64200635 CCACCGTACCTGGCAGACTGGAG No data
Right 931620043 2:64200664-64200686 ACCTCTGTGTCCCAAGTTCAAGG No data
931620038_931620045 29 Left 931620038 2:64200613-64200635 CCACCGTACCTGGCAGACTGGAG No data
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931620038 Original CRISPR CTCCAGTCTGCCAGGTACGG TGG (reversed) Intergenic
No off target data available for this crispr