ID: 931620039

View in Genome Browser
Species Human (GRCh38)
Location 2:64200616-64200638
Sequence GCACTCCAGTCTGCCAGGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931620039_931620045 26 Left 931620039 2:64200616-64200638 CCGTACCTGGCAGACTGGAGTGC No data
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data
931620039_931620043 25 Left 931620039 2:64200616-64200638 CCGTACCTGGCAGACTGGAGTGC No data
Right 931620043 2:64200664-64200686 ACCTCTGTGTCCCAAGTTCAAGG No data
931620039_931620041 -7 Left 931620039 2:64200616-64200638 CCGTACCTGGCAGACTGGAGTGC No data
Right 931620041 2:64200632-64200654 GGAGTGCAGTGATGCCATCTCGG 0: 116
1: 4323
2: 39461
3: 100859
4: 145818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931620039 Original CRISPR GCACTCCAGTCTGCCAGGTA CGG (reversed) Intergenic
No off target data available for this crispr