ID: 931620040

View in Genome Browser
Species Human (GRCh38)
Location 2:64200621-64200643
Sequence TCACTGCACTCCAGTCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931620040_931620045 21 Left 931620040 2:64200621-64200643 CCTGGCAGACTGGAGTGCAGTGA No data
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data
931620040_931620043 20 Left 931620040 2:64200621-64200643 CCTGGCAGACTGGAGTGCAGTGA No data
Right 931620043 2:64200664-64200686 ACCTCTGTGTCCCAAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931620040 Original CRISPR TCACTGCACTCCAGTCTGCC AGG (reversed) Intergenic
No off target data available for this crispr