ID: 931620042

View in Genome Browser
Species Human (GRCh38)
Location 2:64200646-64200668
Sequence GAGGTTGCAGTGAGCCGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47568
Summary {0: 5389, 1: 15264, 2: 13604, 3: 7978, 4: 5333}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931620042_931620050 28 Left 931620042 2:64200646-64200668 CCATCTCGGCTCACTGCAACCTC 0: 5389
1: 15264
2: 13604
3: 7978
4: 5333
Right 931620050 2:64200697-64200719 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
931620042_931620043 -5 Left 931620042 2:64200646-64200668 CCATCTCGGCTCACTGCAACCTC 0: 5389
1: 15264
2: 13604
3: 7978
4: 5333
Right 931620043 2:64200664-64200686 ACCTCTGTGTCCCAAGTTCAAGG No data
931620042_931620045 -4 Left 931620042 2:64200646-64200668 CCATCTCGGCTCACTGCAACCTC 0: 5389
1: 15264
2: 13604
3: 7978
4: 5333
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data
931620042_931620048 27 Left 931620042 2:64200646-64200668 CCATCTCGGCTCACTGCAACCTC 0: 5389
1: 15264
2: 13604
3: 7978
4: 5333
Right 931620048 2:64200696-64200718 ACCTCAGCCTCCCGAGTAGCTGG 0: 6311
1: 132274
2: 300665
3: 217345
4: 143708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931620042 Original CRISPR GAGGTTGCAGTGAGCCGAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr