ID: 931620045

View in Genome Browser
Species Human (GRCh38)
Location 2:64200665-64200687
Sequence CCTCTGTGTCCCAAGTTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931620039_931620045 26 Left 931620039 2:64200616-64200638 CCGTACCTGGCAGACTGGAGTGC No data
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data
931620040_931620045 21 Left 931620040 2:64200621-64200643 CCTGGCAGACTGGAGTGCAGTGA No data
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data
931620038_931620045 29 Left 931620038 2:64200613-64200635 CCACCGTACCTGGCAGACTGGAG No data
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data
931620042_931620045 -4 Left 931620042 2:64200646-64200668 CCATCTCGGCTCACTGCAACCTC 0: 5389
1: 15264
2: 13604
3: 7978
4: 5333
Right 931620045 2:64200665-64200687 CCTCTGTGTCCCAAGTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931620045 Original CRISPR CCTCTGTGTCCCAAGTTCAA GGG Intergenic
No off target data available for this crispr