ID: 931621534

View in Genome Browser
Species Human (GRCh38)
Location 2:64215539-64215561
Sequence CAAAATGCAGAGACTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931621533_931621534 3 Left 931621533 2:64215513-64215535 CCTTATGTATTCTAAAAATGAAC No data
Right 931621534 2:64215539-64215561 CAAAATGCAGAGACTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931621534 Original CRISPR CAAAATGCAGAGACTGCTAT TGG Intergenic
No off target data available for this crispr