ID: 931621958

View in Genome Browser
Species Human (GRCh38)
Location 2:64219424-64219446
Sequence CCTCAAGGATTCCAGGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931621953_931621958 3 Left 931621953 2:64219398-64219420 CCCTGTTCATAGCTGCTGCTTTC No data
Right 931621958 2:64219424-64219446 CCTCAAGGATTCCAGGTATCTGG No data
931621952_931621958 4 Left 931621952 2:64219397-64219419 CCCCTGTTCATAGCTGCTGCTTT No data
Right 931621958 2:64219424-64219446 CCTCAAGGATTCCAGGTATCTGG No data
931621954_931621958 2 Left 931621954 2:64219399-64219421 CCTGTTCATAGCTGCTGCTTTCA No data
Right 931621958 2:64219424-64219446 CCTCAAGGATTCCAGGTATCTGG No data
931621951_931621958 29 Left 931621951 2:64219372-64219394 CCTGAGGCTTCTCTAGTTCAGCT No data
Right 931621958 2:64219424-64219446 CCTCAAGGATTCCAGGTATCTGG No data
931621950_931621958 30 Left 931621950 2:64219371-64219393 CCCTGAGGCTTCTCTAGTTCAGC No data
Right 931621958 2:64219424-64219446 CCTCAAGGATTCCAGGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931621958 Original CRISPR CCTCAAGGATTCCAGGTATC TGG Intergenic
No off target data available for this crispr