ID: 931623172

View in Genome Browser
Species Human (GRCh38)
Location 2:64231377-64231399
Sequence AGTCAGAAGACTTCAGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931623172_931623177 23 Left 931623172 2:64231377-64231399 CCTCAACCTGAAGTCTTCTGACT No data
Right 931623177 2:64231423-64231445 AAGTTGCAAGGATTTGTAACCGG No data
931623172_931623178 30 Left 931623172 2:64231377-64231399 CCTCAACCTGAAGTCTTCTGACT No data
Right 931623178 2:64231430-64231452 AAGGATTTGTAACCGGCTATTGG No data
931623172_931623174 -7 Left 931623172 2:64231377-64231399 CCTCAACCTGAAGTCTTCTGACT No data
Right 931623174 2:64231393-64231415 TCTGACTTCTCTGAACCTAAAGG No data
931623172_931623176 11 Left 931623172 2:64231377-64231399 CCTCAACCTGAAGTCTTCTGACT No data
Right 931623176 2:64231411-64231433 AAAGGAATGAGAAAGTTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931623172 Original CRISPR AGTCAGAAGACTTCAGGTTG AGG (reversed) Intergenic
No off target data available for this crispr