ID: 931624466

View in Genome Browser
Species Human (GRCh38)
Location 2:64244328-64244350
Sequence CAGGCCCACCCTAACATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931624462_931624466 7 Left 931624462 2:64244298-64244320 CCTGTGACAGGTTCCTGGGTGAC No data
Right 931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG No data
931624458_931624466 14 Left 931624458 2:64244291-64244313 CCCATGTCCTGTGACAGGTTCCT No data
Right 931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG No data
931624456_931624466 24 Left 931624456 2:64244281-64244303 CCTGTTCTTTCCCATGTCCTGTG No data
Right 931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG No data
931624459_931624466 13 Left 931624459 2:64244292-64244314 CCATGTCCTGTGACAGGTTCCTG No data
Right 931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG No data
931624455_931624466 25 Left 931624455 2:64244280-64244302 CCCTGTTCTTTCCCATGTCCTGT No data
Right 931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG No data
931624465_931624466 -6 Left 931624465 2:64244311-64244333 CCTGGGTGACTCACAGGCAGGCC No data
Right 931624466 2:64244328-64244350 CAGGCCCACCCTAACATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931624466 Original CRISPR CAGGCCCACCCTAACATTTG TGG Intergenic
No off target data available for this crispr