ID: 931624563

View in Genome Browser
Species Human (GRCh38)
Location 2:64245189-64245211
Sequence ATGTGGGACTGAAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931624563_931624569 5 Left 931624563 2:64245189-64245211 CCAACTTCCCTTCAGTCCCACAT No data
Right 931624569 2:64245217-64245239 TTTTTCATTCTTTTCCTTCAGGG No data
931624563_931624568 4 Left 931624563 2:64245189-64245211 CCAACTTCCCTTCAGTCCCACAT No data
Right 931624568 2:64245216-64245238 CTTTTTCATTCTTTTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931624563 Original CRISPR ATGTGGGACTGAAGGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr