ID: 931629122

View in Genome Browser
Species Human (GRCh38)
Location 2:64283661-64283683
Sequence CTCAGGCATCTCAAAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931629122_931629124 -9 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629124 2:64283675-64283697 ATGCCTGAGTGATGCCGGAATGG No data
931629122_931629130 13 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629130 2:64283697-64283719 GAAATGTTCGGAAGGTAGGAAGG No data
931629122_931629129 9 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629129 2:64283693-64283715 AATGGAAATGTTCGGAAGGTAGG No data
931629122_931629126 1 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629126 2:64283685-64283707 GATGCCGGAATGGAAATGTTCGG No data
931629122_931629128 5 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629128 2:64283689-64283711 CCGGAATGGAAATGTTCGGAAGG No data
931629122_931629132 18 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629132 2:64283702-64283724 GTTCGGAAGGTAGGAAGGGTTGG No data
931629122_931629131 14 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629131 2:64283698-64283720 AAATGTTCGGAAGGTAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931629122 Original CRISPR CTCAGGCATCTCAAAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr