ID: 931629128

View in Genome Browser
Species Human (GRCh38)
Location 2:64283689-64283711
Sequence CCGGAATGGAAATGTTCGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931629121_931629128 18 Left 931629121 2:64283648-64283670 CCTGTGAGGAAATCCAGACTTTT No data
Right 931629128 2:64283689-64283711 CCGGAATGGAAATGTTCGGAAGG No data
931629122_931629128 5 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629128 2:64283689-64283711 CCGGAATGGAAATGTTCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931629128 Original CRISPR CCGGAATGGAAATGTTCGGA AGG Intergenic
No off target data available for this crispr