ID: 931629129

View in Genome Browser
Species Human (GRCh38)
Location 2:64283693-64283715
Sequence AATGGAAATGTTCGGAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931629122_931629129 9 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629129 2:64283693-64283715 AATGGAAATGTTCGGAAGGTAGG No data
931629121_931629129 22 Left 931629121 2:64283648-64283670 CCTGTGAGGAAATCCAGACTTTT No data
Right 931629129 2:64283693-64283715 AATGGAAATGTTCGGAAGGTAGG No data
931629125_931629129 -8 Left 931629125 2:64283678-64283700 CCTGAGTGATGCCGGAATGGAAA No data
Right 931629129 2:64283693-64283715 AATGGAAATGTTCGGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931629129 Original CRISPR AATGGAAATGTTCGGAAGGT AGG Intergenic
No off target data available for this crispr