ID: 931629130

View in Genome Browser
Species Human (GRCh38)
Location 2:64283697-64283719
Sequence GAAATGTTCGGAAGGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931629122_931629130 13 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629130 2:64283697-64283719 GAAATGTTCGGAAGGTAGGAAGG No data
931629125_931629130 -4 Left 931629125 2:64283678-64283700 CCTGAGTGATGCCGGAATGGAAA No data
Right 931629130 2:64283697-64283719 GAAATGTTCGGAAGGTAGGAAGG No data
931629121_931629130 26 Left 931629121 2:64283648-64283670 CCTGTGAGGAAATCCAGACTTTT No data
Right 931629130 2:64283697-64283719 GAAATGTTCGGAAGGTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931629130 Original CRISPR GAAATGTTCGGAAGGTAGGA AGG Intergenic
No off target data available for this crispr