ID: 931629131

View in Genome Browser
Species Human (GRCh38)
Location 2:64283698-64283720
Sequence AAATGTTCGGAAGGTAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931629122_931629131 14 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629131 2:64283698-64283720 AAATGTTCGGAAGGTAGGAAGGG No data
931629125_931629131 -3 Left 931629125 2:64283678-64283700 CCTGAGTGATGCCGGAATGGAAA No data
Right 931629131 2:64283698-64283720 AAATGTTCGGAAGGTAGGAAGGG No data
931629121_931629131 27 Left 931629121 2:64283648-64283670 CCTGTGAGGAAATCCAGACTTTT No data
Right 931629131 2:64283698-64283720 AAATGTTCGGAAGGTAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931629131 Original CRISPR AAATGTTCGGAAGGTAGGAA GGG Intergenic
No off target data available for this crispr