ID: 931629132

View in Genome Browser
Species Human (GRCh38)
Location 2:64283702-64283724
Sequence GTTCGGAAGGTAGGAAGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931629127_931629132 -10 Left 931629127 2:64283689-64283711 CCGGAATGGAAATGTTCGGAAGG No data
Right 931629132 2:64283702-64283724 GTTCGGAAGGTAGGAAGGGTTGG No data
931629125_931629132 1 Left 931629125 2:64283678-64283700 CCTGAGTGATGCCGGAATGGAAA No data
Right 931629132 2:64283702-64283724 GTTCGGAAGGTAGGAAGGGTTGG No data
931629122_931629132 18 Left 931629122 2:64283661-64283683 CCAGACTTTTTGAGATGCCTGAG No data
Right 931629132 2:64283702-64283724 GTTCGGAAGGTAGGAAGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931629132 Original CRISPR GTTCGGAAGGTAGGAAGGGT TGG Intergenic
No off target data available for this crispr