ID: 931632407

View in Genome Browser
Species Human (GRCh38)
Location 2:64312786-64312808
Sequence ACGTAGGAGCTGAGTGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931632407_931632412 13 Left 931632407 2:64312786-64312808 CCTTCTCCACTCAGCTCCTACGT No data
Right 931632412 2:64312822-64312844 ACCCTTAGACCAATTCCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931632407 Original CRISPR ACGTAGGAGCTGAGTGGAGA AGG (reversed) Intergenic
No off target data available for this crispr