ID: 931633625

View in Genome Browser
Species Human (GRCh38)
Location 2:64322808-64322830
Sequence TTCCCAGGAAGCTCCCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931633625_931633635 23 Left 931633625 2:64322808-64322830 CCCCTGAGGGAGCTTCCTGGGAA No data
Right 931633635 2:64322854-64322876 TCTCAGGAGGGCTCAGGAATAGG No data
931633625_931633633 11 Left 931633625 2:64322808-64322830 CCCCTGAGGGAGCTTCCTGGGAA No data
Right 931633633 2:64322842-64322864 TTATTCAGTAGGTCTCAGGAGGG No data
931633625_931633632 10 Left 931633625 2:64322808-64322830 CCCCTGAGGGAGCTTCCTGGGAA No data
Right 931633632 2:64322841-64322863 CTTATTCAGTAGGTCTCAGGAGG No data
931633625_931633634 17 Left 931633625 2:64322808-64322830 CCCCTGAGGGAGCTTCCTGGGAA No data
Right 931633634 2:64322848-64322870 AGTAGGTCTCAGGAGGGCTCAGG No data
931633625_931633630 7 Left 931633625 2:64322808-64322830 CCCCTGAGGGAGCTTCCTGGGAA No data
Right 931633630 2:64322838-64322860 ATCCTTATTCAGTAGGTCTCAGG No data
931633625_931633629 0 Left 931633625 2:64322808-64322830 CCCCTGAGGGAGCTTCCTGGGAA No data
Right 931633629 2:64322831-64322853 CATGCACATCCTTATTCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931633625 Original CRISPR TTCCCAGGAAGCTCCCTCAG GGG (reversed) Intergenic
No off target data available for this crispr