ID: 931636083

View in Genome Browser
Species Human (GRCh38)
Location 2:64341739-64341761
Sequence GAACTTTACTGGAAGGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931636083_931636090 -4 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636090 2:64341758-64341780 GTTCAGCCAATGGGGAGTGAGGG No data
931636083_931636094 13 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636094 2:64341775-64341797 TGAGGGAGGGCAAAAGATATTGG No data
931636083_931636097 26 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636097 2:64341788-64341810 AAGATATTGGAGGTGAAGGAAGG No data
931636083_931636089 -5 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636089 2:64341757-64341779 AGTTCAGCCAATGGGGAGTGAGG No data
931636083_931636096 22 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636096 2:64341784-64341806 GCAAAAGATATTGGAGGTGAAGG No data
931636083_931636095 16 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636095 2:64341778-64341800 GGGAGGGCAAAAGATATTGGAGG No data
931636083_931636091 -1 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636091 2:64341761-64341783 CAGCCAATGGGGAGTGAGGGAGG No data
931636083_931636092 0 Left 931636083 2:64341739-64341761 CCAACTGCCTTCCAGTAAAGTTC No data
Right 931636092 2:64341762-64341784 AGCCAATGGGGAGTGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931636083 Original CRISPR GAACTTTACTGGAAGGCAGT TGG (reversed) Intergenic
No off target data available for this crispr