ID: 931643995

View in Genome Browser
Species Human (GRCh38)
Location 2:64405129-64405151
Sequence GTAGAGCAGGACTACTGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
931643995_931644001 19 Left 931643995 2:64405129-64405151 CCTACACAGTAGTCCTGCTCTAC No data
Right 931644001 2:64405171-64405193 TAACACCTCTTGAACCCGGGAGG No data
931643995_931643998 -9 Left 931643995 2:64405129-64405151 CCTACACAGTAGTCCTGCTCTAC No data
Right 931643998 2:64405143-64405165 CTGCTCTACAGGAGCAGTCATGG 0: 3
1: 42
2: 68
3: 52
4: 183
931643995_931644000 16 Left 931643995 2:64405129-64405151 CCTACACAGTAGTCCTGCTCTAC No data
Right 931644000 2:64405168-64405190 CTGTAACACCTCTTGAACCCGGG No data
931643995_931643999 15 Left 931643995 2:64405129-64405151 CCTACACAGTAGTCCTGCTCTAC No data
Right 931643999 2:64405167-64405189 ACTGTAACACCTCTTGAACCCGG No data
931643995_931644002 22 Left 931643995 2:64405129-64405151 CCTACACAGTAGTCCTGCTCTAC No data
Right 931644002 2:64405174-64405196 CACCTCTTGAACCCGGGAGGCGG No data
931643995_931644004 25 Left 931643995 2:64405129-64405151 CCTACACAGTAGTCCTGCTCTAC No data
Right 931644004 2:64405177-64405199 CTCTTGAACCCGGGAGGCGGAGG 0: 515
1: 14106
2: 71914
3: 152999
4: 154414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
931643995 Original CRISPR GTAGAGCAGGACTACTGTGT AGG (reversed) Intergenic
No off target data available for this crispr